Information

Haben Spermatozoen Mitochondrien?

Haben Spermatozoen Mitochondrien?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Dies ist etwas, über das ich im Laufe der Jahre so viele verschiedene widersprüchliche Behauptungen gehört/gelesen habe.

In der High School wurde mir beigebracht, dass Samenzellen viele Mitochondrien haben, weil sie schnell viel Energie brauchen. Für meinen jugendlichen Verstand machte das Sinn.

Als ich Student war, schwor mein einziger Dozent für Mikrobiologie auf und ab, dass sie keine Mitochondrien hätten. Sie gab nie einen Grund oder Beweise an, aber ich hatte mich an den Gedanken gewöhnt, dass High-School-Informationen oft veraltet und manchmal völlig falsch waren, also ließ ich es gleiten.

Dann las ich vor einigen Jahren einen Artikel für eine Zeitung, der besagte, dass Samenzellen nicht nur Mitochondrien haben, sondern sie nicht alle verloren haben. Dass einige in der Tat konserviert wurden und an der genetischen Rekombination mit den Mitochondrien der Eizelle (den mütterlichen) beteiligt waren. Dies widerspricht einer anderen Regel, die so viele als sicher ansehen, dass die mitochondriale DNA zwar zu 50 % von jedem Elternteil stammt, die mitochondriale DNA jedoch ausschließlich mütterlicherseits ist.

Fazit: Enthalten Spermatozoen Mitochondrien oder nicht? Und wenn ja, ist die oben beschriebene Rekombination wahrscheinlich?


Das Mittelstück hat einen zentralen filamentösen Kern mit vielen spiralförmigen Mitochondrien, die für die ATP-Produktion für die Reise durch den weiblichen Gebärmutterhals, die Gebärmutter und die Eileiter verwendet werden. Dies ist ein guter Artikel, der mehr zu diesem Thema erklärt: http://genetics.thetech.org/ask-a-geneticist/mtdna-comes-only-mom


Hauptfunktionen der Mitochondrien | Biologie

Mitochondrien sind die Atmungszentren der Zelle. Diese Ansicht wurde von Kingsbury (1912) postuliert. Sie speichern Energie in Form von Adenosintriphosphat (ATP), das während der Glykolyse, des Krebszyklus und des Elektronentransportmechanismus der Zellatmung freigesetzt wird.

Die Glykolyse findet im Zytoplasma der Zelle statt, der Krebs-Zyklus findet in den Mitochondrien statt.

Dabei werden die Stoffwechselendprodukte verschiedener Lebensmittel, also Glukose oder Glykogen, Aminosäuren und Fettsäuren zu CO . abgebaut2 und Wasser unter Verwendung von O2, und Energie wird freigesetzt.

Diese Energie ist in Adenosintriphosphat (ATP) eingeschlossen, das bei verschiedenen Körperaktivitäten verwendet wird.

Bild mit freundlicher Genehmigung: upload.wikimedia.org/wikipedia/commons/1/11/Animal_Cell.svg

Glykolyse (Glukose zu Acetyl-Coenzym A):

Glucose + 2ADP + 2 Phosphat + 4 NAD + 2 Coenzym A → 2 Acetylcoenzym A + 2СО2 + 2 ATP + 4 NADH + 4H + (ATP-Ausbeute-2)

Krebs Zyklus:

2 Acetyl-Coenzym A + 6H2O + 2 ADP + 2 Phosphat + 2 FAD + 4 NAD → 6CO2 + 4 ATP + 2 FADH2 + 10 NADH + 10 H + (ATP-Ausbeute-2)

Atmungskette:

2 FADH2 + 4 ADP + 4 Phosphat + O2 → 2 FAD + 4 ATP + 2H2O und (ATP-Ausbeute-4)

10NADH + 10 H + +30 ADP + 30 Phosphat + 5O2 → 10 NAD + 30 ATP + 10 H2O (ATP-Ausbeute-30)

2. Proteolytische Aktivität:

Horning beschrieb, dass Mitochondrien proteolytische Enzymaktivität besitzen. Bei Protozoen hat er sowohl lytische als auch synthetische Aktivität von Mitochondrien nachgewiesen. Bei Amöben fand er heraus, dass Nahrungsreste im Zytoplasma zirkulieren und später mit Mitochondrien in Verbindung gebracht werden.

Er ist der Meinung, dass Mitochondrien für die Produktion von Zymogengranula der Bauchspeicheldrüse verantwortlich sind.

3. Histogenese:

Levi und Chevremont glauben, dass Myofibrillen ein mitochondriales Organ haben. Ihnen zufolge helfen diese Mitochondrien bei der Histogenese (insbesondere Neurofibrillen und Muskelfibrillen).

4. Fettstoffwechsel:

Wotton schlug durch das Studium der Mitochondrien von Trypanosomen vor, dass diese mit dem Fettstoffwechsel in Verbindung stehen. Kürzlich kommen Hinweise auf den Fettstoffwechsel von Bensley (1947) über die Mitochondrien von Leberzellen. Schließlich schlug er vor, dass Mitochondrien tatsächlich eine Reserve an Stoffwechselmaterial für die Zelle darstellen. In keimenden Samen helfen diese bei der diastatischen Aktivität.

5. Erbliche Funktion:

Kürzlich haben Luck et al. (1964) entdeckt, dass Mitochondrien als zytoplasmatische Gene dienen. Sie tragen Charaktere und tragen so zur genetischen Kontinuität von Merkmalen bei.

6. Sie spielen eine wichtige Rolle bei der Bildung von Keimzellen während ihrer Teilung (d. h. Chondrokinese).

7. Mitochondrien sind sich selbst replizierende Organellen. Die Replikation erfolgt als Reaktion auf physiologische Anforderungen. Sie enthalten DNA, Ribosomen und notwendige Enzyme, um die Proteinsynthese sowie die Synthese von Phospholipiden und anderen niedermolekularen Bestandteilen durchzuführen.

8. Bildung der mitochondrialen Spirale in den sich entwickelnden Spermien:

Während der Reifung einer Spermatide zu einem Spermatozoon bilden die Mitochondrien eine spiralförmige Hülle um den axialen Filament des mittleren Spermatozoons. Sheath ist eigentlich eine End-to-End-Assoziation von verlängerten Mitochondrien. Sie liefern Energie für die Bewegung der Spermien.

9. In den Eizellen von Frosch, Rana pipiens und Süßwasserschnecke Planorbis werden einige der Mitochondrien in Dotterkörper umgewandelt. Dotterplättchen sammeln sich in den Mitochondrien an und verdrängen die Cristae in Richtung Peripherie, wodurch die Mitochondrien in Dotterkörper umgewandelt werden.


Spermatogenese: Hinweise zur Spermatogenese (1514 Wörter) | Biologie

Die Spermatogenese bei Säugetieren ist ein hochsynchronisierter, regelmäßiger, langer und äußerst komplexer Prozess der zellulären Differenzierung, durch den eine spermatogoniale „Stammzelle“ allmählich in eine hochdifferenzierte haploide Zelle „Spermatozoon“ umgewandelt wird.

Diese Differenzierung umfasst drei verschiedene Klassen von Keimzellen – die Spermatogonien, die Spermatozyten und die Spermatiden, die normalerweise in konzentrischen Schichten in den Samenkanälchen angeordnet sind.

Bild mit freundlicher Genehmigung: tokresource.org/spermatogenesis.jpg

Bei erwachsenen Säugetieren ist die Spermatogenese ein kontinuierlicher Prozess, der in zwei unterschiedliche Phasen unterteilt werden kann und jede durch spezifische morphologische und biochemische Veränderungen nuklearer und zytoplasmatischer Komponenten gekennzeichnet ist.

Die beiden Phasen umfassen:

(i) Bildung von Spermatiden (Mitose und Meiose) und

Bildung von Spermatiden:

Diese Phase der Spermatogenese wird weiter in drei Phasen unterteilt.

1. Multiplikationsphase:

Diese Phase wird auch als Proliferation und Erneuerung von Spermatogonien bezeichnet. Während dieser Phase vermehren sich die diploiden Spermatogonien, die sich an der Peripherie des Samenkanälchens befinden, mitotisch zu Spermatozyten und auch zu neuen Spermatogonien! Stammzellen und treten in die Wachstumsphase ein.

2. Wachstumsphase:

Während dieser Phase findet ein begrenztes Wachstum von Spermatogonien statt, deren Volumen sich verdoppelt und sie werden jetzt als primäre Spermatozyten bezeichnet, die noch immer diploid sind. Nun treten diese primären Spermatozyten in die nächste Phase ein, nämlich die Reifungsphase.

3. Reifephase:

Die primären Spermatozyten treten in die Prophase der meiotischen oder Reifungsteilung ein. Die meiotische Prophase ist ein sehr komplexer Prozess, der durch eine geordnete Reihe von Chromosomenumlagerungen gekennzeichnet ist, die von molekularen Veränderungen begleitet werden. Während der Meiose dupliziert sich die erste Kern-DNA, jedes homologe Chromosom beginnt sich zu paaren (Synapse) und teilt sich in Längsrichtung in zwei Chromatiden auf, die beide durch ein gemeinsames Zentromer verbunden bleiben.

Durch Chiasmabildung kommt es zu einem gegenseitigen Austausch von etwas Chromosomenmaterial zwischen zwei Nicht-Schwesterchromatiden jedes homologen Paares (Tetrade) (Crossing-Over), um eine fast unbegrenzte Vielfalt von Kombinationen von väterlichen und mütterlichen Genen in jedem Gameten bereitzustellen.

Schließlich wandern zwei Chromosomen jedes homologen Paares (Tetrade) zu entgegengesetzten Polen des primären Spermatozyten. Jetzt hat jeder Pol der primären Spermatozyten einen haploiden Chromosomensatz. Jeder Chromosomensatz ist von der Kernmembran umgeben, die sich aus dem endoplasmatischen Retikulum entwickelt. Auf die erste meiotische Teilung folgt in der Regel die Teilung des Zytoplasmas (Zytokinese), die jeden primären Spermatozyten in zwei haploide, sekundäre Spermatozyten teilt.

Jeder sekundäre Spermatocyt durchläuft eine zweite meiotische oder Reifungsteilung, die eine einfache Mitose ist und vier haploide Spermatiden produziert. Dies sind nicht funktionsfähige männliche Gameten. Um funktionsfähige Spermatozoen zu werden, müssen sie einen komplexen Prozess zytologischer und chemischer Transformationen durchlaufen, der üblicherweise als Spermiogenese bezeichnet wird.

Spermiogenese:

Die Veränderungen der Spermatiden, die zur Bildung von Spermatozoen führen, bilden den Prozess der Spermiogenese. Da ein Spermatozoon eine sehr aktive und mobile Zelle ist, müssen alle überflüssigen Materialien der sich entwickelnden Spermatozoen verworfen werden und in der Samenzelle durch eine Reihe von Schritten ein hoher Spezialisierungsgrad durchgeführt werden, um ihm echte Mobilität zu verleihen.

Während der Spermiogenese werden zwei Hauptteile des Spermas, der Kopf und der Schwanz, durch den folgenden Prozess gebildet.

1. Kopfbildung:

Die beiden Hauptteile des Spermienkopfes, d. h. der Kern und das Akrosom, unterliegen den folgenden Veränderungen, um einen Spermienkopf zu bilden.

(ein) Veränderungen im Kern:

Während der Spermiogenese schrumpft der Kern der Spermatide, indem er viel Wasser aus der Kernkappe verliert, und die Chromosomen werden eng zu einem kleinen Volumen gepackt. Die gesamte Ribonukleinsäure wird eliminiert, so dass nur das genetische Material, das Desoxyribonukleo-Protein, übrig bleibt. Damit wird das Material, das sich nicht direkt auf die Verwandlung erblicher Merkmale bezieht, aus dem Kern entfernt.

Auch die Kugelform des Kerns wird länglich und schmal. Diese Form ist eine offensichtliche Anpassung für den Vortrieb in jedem flüssigen Medium sowie das Eindringen in die Eizelle. Bei verschiedenen Tieren nimmt es verschiedene Formen an, die letztendlich ihre zukünftigen Formen bestimmen.

Die junge Spermatide ist rund mit einem kugelförmigen Kern. Der Golgi-Apparat sondert glykoproteinreiche Granula ab, die mit der Periodsäure-Schiff-Technik gefärbt werden. Diese Körnchen, die als proakrosomische Körnchen bezeichnet werden, verschmelzen, um ein einzelnes großes akrosomales Körnchen zu bilden, das an der Kernmembran befestigt ist.

Das akrosomale Körnchen flacht auf dem Kern der Spermatide ab, um die Kopfkappe zu bilden. Der Golgi-Apparat, der das Akrosom absondert, löst sich von der Kopfkappe und bewegt sich zum Gegenpol. Die kernnahen Centriolen entwickeln auf der der Akrosonickappe gegenüberliegenden Seite ein Flagellum.

(D) Akrosomphase:

Die definitiven morphologischen Konturen des Akrosoms werden klar definiert. Der verbleibende Teil des Golgi-Apparates wird nach und nach reduziert und schließlich zusammen mit etwas Zytoplasma als „Golgi-Rest“ aus den Spermien ausgeschieden (Abb. 6).

Im Spermatozoon erscheint der axiale Körper oder akrosomale Kern zwischen dem Akrosomgranulat und dem Kern und produziert sich von hinten in das Akrosomgranulat. Dieser Körper entwickelt sich während seiner Annäherung an das Ei. Es enthält einige Enzyme, die dazu dienen, die Eimembranen während des Befruchtungsprozesses aufzulösen (Colwin und Colwin, 1961).

2. Bildung des Schwanzes des Spermatozoons:

Das Centrosom einer Spermatide nach der zweiten meiotischen Teilung besteht aus zwei Centriolen, die die Struktur zweier zylindrischer Körper haben, die im rechten Winkel zueinander liegen. Während der frühen Stadien der Spermienmetamorphose bewegen sich die beiden Centriolen in eine Position direkt hinter dem Spermienkern in der zukünftigen Halsregion. In der Hinterfläche des Kerns bildet sich eine Vertiefung, in die einer der beiden Centriolen mit seiner Achse etwa im rechten Winkel zur Hauptachse des Spermatozoons platziert wird.

Dies ist die proximale Centriole und die andere Centriole, d. h. die distale Centriole nimmt eine Position hinter der proximalen ein, wobei ihre Achse mit der Längsachse des Spermatozoons zusammenfällt. Aus der distalen Centriole entsteht nun das Axis-Filament des Flagellums des Spermatozoons, dem es als Basalgranulat dient.

Die meisten Mitochondrien der Spermatiden konzentrieren sich um das distale Centriole und den proximalen (oberen) Teil des axialen Filaments und bilden den Hals und das Mittelstück des Schwanzes des Spermatozoons. Im Mittelstück des Spermas verlieren die Mitochondrien ihre Individualität durch mehr oder weniger starke Verschmelzung. Bei Säugetieren vereinigen sich die Mitochondrien zu einem kontinuierlichen Körper, der sich spiralförmig um den proximalen Teil des axialen Filaments und die proximale Centriole dreht.

Bei anderen Tieren tritt jedoch keine spiralförmige Anordnung der Mitochondrien auf, sondern die Mitochondrien verschmelzen zu massiven Klumpen, die als Mitochondrienkörper bezeichnet werden. Das Zytoplasma bildet eine kondensierte Schicht, die Sanchette genannt wird, um die Peripherie des Mittelstücks. Die Manchette umgibt auch den hinteren Teil des Kopfes der Spermatozoen, wo er nicht von der Kappe bedeckt ist.

Ein dunkler Ring namens „Ring Centriole“ unbekannter Funktion ist manchmal am hinteren Ende des Mittelstücks zu sehen. Es bildet die Grenze zwischen dem Mittelstück und dem Hauptstück des Spermaschwanzes. Bei den meisten Tieren, mit Ausnahme von Säugetieren, bestehen das Hauptstück und das Schwanzstück des Spermas nur aus dem axialen Filament. Bei Säugetieren wird das axiale Filament des Hauptstücks an der Außenseite von viel dickeren Fasern begleitet, die im Querschnitt keilförmig sind.

Diese Fasern beginnen im Mittelstück, reichen aber nicht bis zum Endstück des Spermatozoonschwanzes. Die Fasern des axialen Filaments eines Säugerspermaschwanzes sind auch von abgeflachten Bändern umgeben, die als halbkreisförmige Rippen auftreten, die an den gegenüberliegenden Seiten des Spermaschwanzes miteinander artikulieren (Telkka, Fawcett und Christensen, 1961). Das Endstück hat nur axiales Filament, das mit Zytoplasma und Plasmamembran bedeckt bleibt.

Biochemische Veränderungen der Spermatogenese:

Während der Spermatogenese treten eine Reihe biochemischer Ereignisse auf (Monesi, 1970). Diese sind:

(1) Die während der Meiose synthetisierte RNA wird während der beiden meiotischen Teilungen aus dem Kern eliminiert und verbleibt im Zytoplasma. Das vollständig ausgebildete Spermatozoon enthält keine nachweisbaren Mengen an RNA. Die meiotische RNA ist wahrscheinlich mit der Synthese von akrosomalen Proteinen und Flagellum verbunden.

(2) Die Kernproteinsynthese wird mitten in der Spermiogenese angehalten.

(3) Alle Nicht-Histon-Proteine ​​im Zellkern werden während der Spermiogenese eliminiert.

(4) Alle synthetischen Ereignisse, die während der Spermiogenese auftreten, werden wahrscheinlich durch stabile RNA reguliert, die während der meiotischen Stadien produziert wird.

(5) Die Unterdrückung der genetischen Aktivität in Spermatiden und Spermatozoen kann von einem Regulationsmechanismus abhängen, der das Verschwinden von aktivierenden Proteinen und RNA von den Chromosomen verursacht.

(6) Die mit der DNA assoziierten Histonmoleküle können eine schützende Rolle spielen, indem sie die DNA gegen Veränderungen stabilisieren, die bei ihrem Transport durch den männlichen und weiblichen Fortpflanzungstrakt auftreten (Taiwan et al., 1989).

Kontrolle der Spermatogenese:

Die Spermatogenese wird entweder umweltbedingt oder physiologisch kontrolliert. Temperatur, Licht, Hormone und psychische Verfassung spielen je nach Organismus eine wichtige Rolle. Die Hypophyse spielt eine wichtige Rolle bei der Regulierung der Spermatogenese, indem sie bestimmte Gonadotropin-Hormone absondert. Aber die Hypophyse selbst und die Gonadenaktivitäten von Vögeln, Nagetieren und vielen anderen Wirbeltieren werden von der Temperatur, dem Licht und der Länge des Tages beeinflusst.


Die lange oder die kurze Sicht nehmen

In unserer neuen Studie zeigen wir, dass diese Ausnahmen aufgrund eines sexuellen Konflikts um die Kontrolle der mitochondrialen Vererbung entstehen.

Durch mathematische Modellierung fanden wir heraus, dass sich die Evolution bei Frauen tendenziell auf langfristige Auswirkungen konzentriert. Die Zerstörung der väterlichen Mitochondrien macht es in Zukunft einfacher, schädliche Mutationen auszusortieren, aber dieser Effekt entfaltet sich über viele Generationen. Diese Strategie funktioniert bei Frauen gut, da immer wieder der gleiche gesunde Satz mütterlicher Mitochondrien über die weibliche Linie weitergegeben wird.

Männchen haben in diesem Fall jedoch keinen langen evolutionären Zeithorizont. Da die meisten ihrer Mitochondrien zu Beginn jeder Generation durch mütterliche ersetzt werden, kann die Evolution keinen langfristigen Nutzen aus den mitochondrialen Genen des Mannes erkennen. Da es keine langfristige Verbindung gibt, können sie nur in unmittelbarer Zukunft profitieren, und das bedeutet oft, dass sie einen Teil ihrer Mitochondrien jetzt schon weitergeben. Männchen versuchen daher kurzfristig die Fitness ihrer Nachkommen zu verbessern, auch wenn die langfristigen Auswirkungen schädlich sind.

Es sind diese unterschiedlichen Interessen von Männern und Frauen, die zu einem evolutionären Wettrüsten führen können, da die Selektion bei den beiden Geschlechtern in entgegengesetzte Richtungen wirkt. Die Evolution der Weibchen strebt danach, die zukünftigen Generationen frei von männlichen Mitochondrien zu halten, während die Männchen alles daran setzen, einige ihrer Mitochondrien in die Mischung zu bekommen.

&bdquoMänner haben sich immer wieder Wege einfallen lassen, die Zerstörung ihrer Mitochondrien durch die Frau zu untergraben&rdquo, sagte mein Co-Autor, der Genetiker Andrew Pomiankowski. &bdquoDaher mussten Frauen neue Wege finden, um männliche Mitochondrien zu blockieren. Unser Modell erklärt gut, warum es so viele verschiedene Mechanismen gibt, die verwendet werden, um männliche Mitochondrien auszuschließen, und warum Männer dies manchmal selbst tun.&rdquo

Es dreht sich alles um die Kontrolle der mitochondrialen Vererbung und für Männer ist es besser, auf dem Fahrersitz zu entscheiden, wie viele Mitochondrien sie zum Mix beitragen, als komplett ausgeschlossen zu werden.


Materialen und Methoden

Konstruktion einer Lewis-Ratten-Testis-cDNA-Expressionsbibliothek

Poly(A) + mRNA wurde aus frisch geernteten Lewis-Ratten-Hoden unter Verwendung von Guanidinisothiocyanat-Extraktion und Oligo(dT)-Cellulose-Chromatographie isoliert und gereinigt, wie von Freemerman et al. [ 32, 33]. Eine Hoden-Expressionsbibliothek wurde unter Verwendung des Zap-cDNA-Synthese-Kits von Stratagene gemäß den Anweisungen des Herstellers (Stratagene, La Jolla, CA) konstruiert. Das System verwendete einen Oligo(dT)-Primer mit einem XhoIch stelle und ÖkoRI-Adapter zur Erzeugung doppelsträngiger cDNA aus 5 µg der poly(A) + RNA. Die Proben wurden vor der Ligation in Uni-Zap XR Vector Arms (Stratagene) größenfraktioniert und wurden dann mit Gigapack II Gold-Extrakten (Stratagene) in Lambda-Hüllproteine ​​verpackt. Die Bibliothek wurde einmal durch den XL-Blue MRF′-Stamm von Stratagene amplifiziert Escherichia coli.

Screening der Bibliothek

Nach den von Maniatis [ 34] beschriebenen Verfahren wurde die Expressionsbibliothek mit einer 1:500-Verdünnung von Lewis-Ratten-Hyperimmunseren gescreent, die durch Immunisieren von Ratten mit isologen Cauda-Nebenhoden-Spermien [ 28] produziert wurden. Ungefähr 5 × 10 6 Phagen wurden in der ersten Screeningrunde ausplattiert. Anfängliche Klone wurden bis zur Reinheit isoliert, durch Phagemid-Rescue in Bluescript SK + -Plasmid umgewandelt, wie im Protokoll von Stratagene beschrieben, und unter Verwendung des Desoxykettenterminationsverfahrens und Sequenase (United States Biochemical Corp., Cleveland, OH) [32] sequenziert.Eine cDNA-Sonde aus dem längsten dieser Klone, 1-1-1-3-2, wurde verwendet, um ungefähr 1 × 10 7 Phagen auf zusätzliche Klone zu screenen [34]. Sechzehn Mikrogramm des Klon-1-1-3-2-Plasmids wurden gleichzeitig mit . verdaut ÖkoRI/XhoI (Promega, Madison, WI) und das Insert wurde durch Elektrophorese auf einem 1% Agarosegel, gefolgt von Elektroelution, isoliert. Das resultierende Fragment wurde mit [α- 32 P]dCTP unter Verwendung der Protokolle des Gibco-BRL Nick-Translation Kits (Gibco, Grand Island, NY) markiert und wurde verwendet, um den Klon voller Länge zu isolieren.

Expression von rekombinantem SMCP (rec-SMCP) Protein

Volllängen-Expressionskonstrukte von SMCP wurden in den pET-22b+-Expressionsvektor (Novagen, Madison, WI) konstruiert. Die Konstrukte umfassten 24 Basen einer 5-Prime-Sequenz, da die Literatur zu Beginn dieser Arbeit darauf hinwies, dass das Startcodon für SMCP weiter stromaufwärts lag [35] als das derzeit akzeptierte Startcodon. Der Vektor verleiht dem rekombinanten Protein (rec-Protein) ein N-terminales pelB-Signalpeptid, um die zytosolische Expression zu verstärken, und fügt dem C-Terminus 6 Histidinreste zur Reinigung durch Ni-Affinitätschromatographie hinzu. Die folgenden Oligonukleotidprimer wurden von der Biomolecular Research Facility der University of Virginia synthetisiert: 137 (5′-GGGGAATTC G TCAGAAAACTCCAACTCTAAAG) und 595 (5′-CCCCTCGAGCTTGGTCTTCTTCTGGTTCCA). Für die gerichtete Klonierung in den Vektor enthält der 5′-Primer 137 einen ÖkoRI-Stelle (in fetter Kursivschrift gezeigt) und der 3′-Primer 595 des reversen Komplements enthält einen XhoI Website (fett kursiv). Außerdem enthält der 5'-Primer ein Spacer-Nukleotid (unterstrichenes G), um den Vektorleserahmen im rekombinanten Konstrukt zu erhalten. Polymerase-Kettenreaktionsfragmente entsprechend der Sequenz (Nukleotide 137–595) wurden unter Verwendung des Primer-Sets 137/595 amplifiziert. Alle rekombinanten DNA-Verfahren wurden wie von Maniatis [34] beschrieben durchgeführt. Sowohl die gentechnisch veränderten Inserts als auch die Vektor-DNA wurden mit . verdaut ÖkoRI und Xhoich nacheinander. Die verdaute Vektor-DNA wurde vor der Ligation mit Kälberdarmphosphatase behandelt. Die Ligation wurde bei 16°C über Nacht durchgeführt [ 34]. Fünf Milliliter jeder Ligationsreaktion wurden in kompetentes BL-21 . transfiziert E coli (Novagen) und auf Ampicillin-Resistenz auf NZY-Ampicillin-Agarplatten selektiert. Kolonien wurden selektiert und die isolierten Plasmide wurden analysiert durch ÖkoRI/XhoI Verdau für die entsprechenden rekombinanten Inserts. Die Konstrukte wurden wie oben von beiden Seiten der Inserts sequenziert, um sicherzustellen, dass der korrekte Leserahmen für den Vektor erhalten blieb. Um die Gesamtausbeute an exprimiertem Protein zu erhöhen, wurde das Konstrukt in BL-21 pLysS . transfiziert E coli (Novagen), das die Transkriptionsrate des Gens steuert und den Zelltod aufgrund einer Überproduktion des Proteins verhindert.

Die Herstellung und Reinigung des rec-SMCP-Proteins erfolgte wie von Reddi et al. [36]. Kurz gesagt wurden 10 l Terrific Broth (3-Stärke) [37] mit 50 &mgr;g/ml Carbenicillin mit 200 ml einer Übernachtkultur des pET-22b-Konstrukts in BL-21-pLysS-Wirtsbakterien angeimpft. Die Zellen wurden mit 1 mM Isopropylthiogalactosid (IPTG) induziert, wenn sie eine Dichte von A . erreicht hatten600 = 0,97, und die Induktion des rec-Proteins wurde 5 h fortgesetzt. Die Zellen wurden geerntet, unter langsamer Zentrifugation pelletiert und bei –20°C gelagert. Die Reinigung des löslichen rec-Proteins erfolgte durch Ni-Affinitätschromatographie [36].

Generierung polyklonaler Aszites und Seren

Maus-anti-Ratte 137/595 rec-SMCP polyklonaler Aszites wurde im Lymphocyte Culture Center (LCC) der University of Virginia erzeugt. Präimmune Blutproben wurden aus den Schwanzvenen von drei 6 bis 8 Wochen alten weiblichen Balb/c-Mäusen entnommen. Das Immunogen für jede Injektion war 20 &mgr;g des Ni-affinitätsgereinigten 137/595 rec-SMCP, das durch SDS-PAGE gelgereinigt wurde. Die 22,5 kDa Acrylamidscheibe wurde in komplettem Freund'schem Adjuvans für die ersten beiden Injektionen und in inkomplettem Freund'schem Adjuvans für die dritte emulgiert. Jedes Tier erhielt 3 Injektionen in den Wochen 0, 5 und 11, die Hälfte des Immunogens wurde s.c. injiziert. und halb intraperitoneal. Das Abdomen wurde in Woche 11 mit Pristan geprimt, und die Bildung eines Aszites-Tumors wurde durch Injektion von nicht-sekretierenden SP2/0-Ag14 [38] Maus-Myelomzellen 10 Tage nach dem Primen festgestellt. Schein-Aszites-Flüssigkeiten wurden auf identische Weise erzeugt, nach Immunisierung mit Acrylamid-Schnitten, denen jegliches Protein fehlte. Aszitesflüssigkeiten von beiden Mäusesätzen wurden über mehrere Wochen gesammelt und durch Zentrifugieren der Flüssigkeit und Entfernen des Aszites unter der Lipidschicht von Lipiden befreit.

Kaninchen-anti-Ratte 137/595 rec-SMCP polyklonale Seren wurden in 3 weiblichen weißen Neuseeland-Kaninchen (7–8 lbs) erzeugt. Nachdem die Präimmunseren gesammelt wurden, erhielt jedes Tier eine Injektion von 300 &mgr;g rec-Protein, das wie oben beschrieben gelgereinigt wurde. Die Hälfte der Emulsion wurde i.m. injiziert. und die Hälfte in den Kniekehlenlymphknoten. Nach der ersten Immunisierung mit Freunds vollständigem Adjuvans wurden jede fünfte Woche drei Auffrischungsimmunisierungen unter Verwendung von Freunds unvollständigem Adjuvans verabreicht, und Serumproben wurden 1 Woche nach der letzten Auffrischung gesammelt.

Analyse von Rec-Protein und polyklonalen Antikörpern

SDS-PAGE und Western Blotting

Proteine ​​wurden in Laemmli-Puffer [39] solubilisiert. Ein 7,5–15 % Gradient oder 10 % lineares Trenngel wurde 4 h bei 30 mA laufen gelassen, und die Proteine ​​wurden entweder silbergefärbt oder auf 0,45 μm NitroPure Nitrocellulose (Micron Separations Inc., Westborough, MA) bei 100 mA für elektrotransferiert 14 Std. Die Blots wurden mit 0,1 % Amidoschwarz gefärbt und in 10 % Methanol und 10 % Essigsäure entfärbt. Die Membran wurde in Streifen geschnitten, die in 5 % Milch in PBS mit 0,05 % Tween-20 (PBS-tw) für 2 h blockiert wurden. Rattenserumproben wurden mit einem E coli Lysat und die Primärseren wurden über Nacht bei 4°C in unterschiedlichen Verdünnungen inkubiert. Nach der Primärantikörper-Inkubation wurden die Streifen 3 × 5 min in PBS-tw gewaschen. Die Peroxidase-konjugierten Sekundärantikörper wurden beim Ziegen-anti-Kaninchen-IgG 1:10000 bzw. beim Kaninchen-anti-Ratten-IgG 1:5000 verdünnt. Die Verdünnungen wurden in PBS-tw hergestellt und die Inkubation erfolgte 1,5 h bei 22 °C. Die Streifen wurden dreimal 5 min lang in PBS-tw gewaschen und jeder Blot wurde unter Verwendung von 0,2% Diaminobenzidin-Substrat, verstärkt mit 0,1% Nickelchlorid und 0,1% H&sub2;2Ö2 in 0,1 M Trizma-Base.

Olmstead-Elution des Antikörpers

Zur Reinigung von Anti-SMCP-Antikörpern aus polyklonalen Kaninchenseren wurde die Immunaffinitätsmethode von Olmstead verwendet [ 27, 40]. Einhundert Mikrogramm gereinigtes rec-SMCP wurden auf ein SDS-PAGE-Vorhanggel geladen, das wie zuvor beschrieben laufen gelassen und übertragen wurde. Die 22- bis 25-kDa-rec-SMCP-Region wurde horizontal aus dem Blot ausgeschnitten, für 2 h in 5% Milch blockiert und über Nacht bei 4 °C mit einer 1:1000-Verdünnung von polyklonalem Kaninchen-anti-rec-SMCP-Antikörper (Präimmun) inkubiert oder postimmun). Nach 3 × 30 min Waschen in PBS-tw wurde der gereinigte Antikörper vom Streifen durch zweimaliges Inkubieren für jeweils 6 min mit 1 ml 0,2 M Glycin/0,5 M NaCl (pH 3,5) eluiert. Nach der Inkubation wurde jeweils 1 ml Antikörperlösung sofort mit NaOH neutralisiert und 1% Gew.:Vol. BSA wurde zugegeben, um den Antikörper zu stabilisieren. Der Streifen wurde in 100 mM Tris/0,5 M NaCl (pH 8,0) gelegt und 15 min inkubiert. Der Streifen wurde dann über Nacht mit der ursprünglichen Antikörperlösung inkubiert und der Vorgang wurde am nächsten Tag ein zweites Mal wiederholt.

Immunfluoreszenz

Erwachsene Lewis-Ratten wurden getötet und die Cauda epididymidis und der Samenleiter wurden entfernt. Die Spermien wurden durch Einführen einer Spülkanüle in den proximalen Vas und Spülen des Inhalts aus dem Vas und der distalen Cauda des Nebenhodens mit TE-Kulturmedium gewonnen [ 41]. Die Spermien wurden zweimal mit TE-Kulturmedium gewaschen und durch Zentrifugation gesammelt. Fünf Milliliter Medium wurden auf das Pellet geschichtet, und die Spermien wurden 1 Stunde lang bei 37 °C in einer 5% CO .-Lösung aufschwimmen gelassen2 Inkubator. Die Swim-up-Spermien wurden unter Verwendung eines Hämozytometers gezählt und auf eine Konzentration von 1 × 10 6 Spermien/ml verdünnt. Zwanzig Mikroliter der Spermiensuspension wurden pro Vertiefung (2 × 10 5 Spermien) auf poly-l-Lysin-beschichtete Objektträger gegeben, und die Spermien wurden 7 Minuten lang an den Objektträger binden gelassen, bevor die überschüssigen Spermien entfernt wurden. Die Objektträger wurden bei 40 °C getrocknet und dann 10 min mit Methanol fixiert. Nach drei 5-minütigen Waschungen in PBS wurden alle nachfolgenden Inkubationen in einer feuchten Kammer durchgeführt. Die Präparate wurden in 10 % normalem Ziegenserum (NGS) in PBS-tw für 30 min blockiert. Der primäre Kaninchen-anti-rec-SMCP-Antikörper wurde mit 10 % NGS in PBS-tw 200-fach verdünnt und über Nacht bei 4°C inkubiert. Die Objektträger wurden dann 3 × 5 min in PBS-tw gewaschen und der sekundäre Antikörper, Ziegen-anti-Kaninchen-IgG, konjugiert mit Fluoresceinisothiocyanat (Jackson ImmunoResearch, West Grove, PA), wurde in einer Verdünnung von 1:100 in 10 % NGS . aufgetragen in PBS-tw für 2 h bei 37 °C. Die Objektträger wurden 3 × 5 min in PBS-tw gewaschen und das Slow Fade-Light Antifade Kit (Molecular Probes, Inc., Eugene, OR) wurde verwendet, um die Verblassungsrate des Fluoresceins zu reduzieren.


Ergebnisse

Mitochondriale Ubiquitinierung von Spermien nach Befruchtung

Um die Ubiquitinierung der väterlichen Mitochondrien nach der Befruchtung zu überwachen, verwendeten wir Bullensperma, das mit der lebenswichtigen Fluoreszenzsonde MitoTracker Green FM [ 8] für die IVF von Rindereizellen vormarkiert war. Die resultierenden Zygoten wurden mit rot fluoreszierenden Konjugaten von Anti-Ubiquitin-Antikörpern und blau fluoreszierender DNA-Färbung DAPI markiert. Obwohl kürzlich eingebaute Spermien mit geschwollenen Kernen keine Markierung aufwiesen ( 1A ), wurde Ubiquitin auf den eingebauten Spermienmitochondrien in den späten Stadien der Vorkernentwicklung nachgewiesen ( 1 B und C). Die Intensität der Ubiquitin-Markierung der mitochondrialen Hülle nahm mit dem Fortschreiten der pronukleären Apposition zu ( Fig. 1C 16 h nach der Insemination [p.i.]) und kulminierte während der ersten mitotischen Teilung ( Fig. 1, D und E). In der Metaphase der ersten Mitose wurde die ubiquitinierte Mitochondrienscheide an einem Spindelpol (Abb. 1D 24 h pi) und eine deutliche Sequestrierung von Ubiquitin gefunden, ähnlich der, die in den meiotischen Spindeln von Rhesus (siehe Abb. 1M) und Kuh . beobachtet wurde (nicht gezeigt) Oozyten, wurde gesehen. Nach Abschluss der ersten embryonalen Mitose wurde nur in einem der beiden Blastomeren eine deformierte Mitochondrienscheide gefunden ( Abb. 1, F und G 40 h p.i.). Die Spermienmitochondrien verschwanden typischerweise im Vier- bis Achtzellstadium der Präimplantationsentwicklung ( Abb. 1H 48 h p.i.). Oozytenmitochondrien enthielten selbst nach parthenogenetischer Aktivierung kein Ubiquitin ( Fig. 1, I und I'). Die Antikörper (siehe Materialen und Methoden) gegen bovines Erythrozyten-Ubiquitin kreuzreagierte auch mit dem Spermienschwanzmittelstück in Mauszygoten (Abb. 1J), und die Antikörper gegen rekombinantes humanes Ubiquitin wiesen eingebaute Spermienmitochondrien in Rhesusaffenzygoten nach (Abb. 1, K–N). Ähnlich wie bei bovinen Zygoten wurde Ubiquitin in Rhesusspermien-Mitchondrien in den frühen Stadien nach der Inkorporation nicht nachgewiesen ( Abb. 1L), während es während der nachfolgenden Vorkernentwicklung vorhanden war ( Abb. 1, K–N). Die Ubiquitinierung der zweiten meiotischen Spindel und ihres Mittelkörpers wurde regelmäßig in frühen vorkernigen Rhesuszygoten gefunden ( Abb. 1M) und stimmt mit der bekannten Rolle von Ubiquitin bei der Zellzyklusregulation überein [ 15]. Die rote Hintergrundmarkierung im Zytoplasma der Eier war höchstwahrscheinlich auf die ubiquitinierten zytoplasmatischen Substrate und/oder auf das Vorhandensein von unkonjugiertem Ubiquitin im Zytosol zurückzuführen.

Ubiquitinierung der Spermienmitochondrien im Zytoplasma der Eizelle bei Rindern (A–J), Maus (K) und Rhesusaffe (L). Ubiquitin (rot) wurde mit monospezifischen Antikörpern in den Eizellen nachgewiesen, die von Spermien befruchtet wurden, die mit einer lebenswichtigen Fluoreszenzsonde MitoTracker Green FM (grün A–G Ich, K–N) in bovinen Zygoten kurz nach der Spermieninkorporation (EIN in diesem Stadium wird kein Ubiquitin auf der Mitochondrienscheide gefunden) während der pronukleären Apposition (B, C) in der Metaphase (D beachten Sie die Sequestrierung von Ubiquitin in der Metaphase-Spindel) und Anaphase (E) der ersten Mitose in der Interphase, zwei Zellembryonen (F, G) und in einem achtzelligen Embryo, bei dem die Spermienmitochondrien nicht nachgewiesen wurden (h). Die MitoTracker-markierten Mitochondrien parthenogenetisch aktivierter Eier (ich) enthielt kein Ubiquitin (ICH'), während es auf dem axonemalen Mittelstück bei pronuklearen Mäusen nachgewiesen wurde (J Pfeile) und Rhesusaffe (K–N) Embryonen. Beachten Sie die Beschriftung der zweiten meiotischen Spindel in m. F, M) Pfeile zeigen auf die mitochondriale Hülle der Spermien. Die Anwesenheit von unkonjugiertem Ubiquitin und/oder ubiquitinierten Substraten im Zytosol ist höchstwahrscheinlich für die rote Hintergrundmarkierung im Eizytoplasma verantwortlich. Maßstabsleisten: F und h = 15 μm ich und ICH' = 2 μm J = 5 μm n und m = 10 μm. Vergrößerung für EIN, ×2000 B, ×1500 CE, ×1000 g, ×1000 J, ×500 K, ×750 L, ×250.

Ubiquitinierung der Spermienmitochondrien im Zytoplasma der Eizelle bei Rindern (A–J), Maus (K) und Rhesusaffe (L). Ubiquitin (rot) wurde mit monospezifischen Antikörpern in den Eizellen nachgewiesen, die von den Spermien befruchtet wurden, die mit einer lebenswichtigen Fluoreszenzsonde MitoTracker Green FM (grün A–G Ich, K–N) in bovinen Zygoten kurz nach der Spermieninkorporation (EIN in diesem Stadium wird kein Ubiquitin auf der Mitochondrienscheide gefunden) während der pronukleären Apposition (B, C) in der Metaphase (D beachten Sie die Sequestrierung von Ubiquitin in der Metaphase-Spindel) und Anaphase (E) der ersten Mitose in der Interphase, zwei Zellembryonen (F, G) und in einem achtzelligen Embryo, in dem die Spermienmitochondrien nicht nachgewiesen wurden (h). Die MitoTracker-markierten Mitochondrien parthenogenetisch aktivierter Eier (ich) enthielt kein Ubiquitin (ICH'), während es auf dem axonemalen Mittelstück bei pronuklearen Mäusen nachgewiesen wurde (J Pfeile) und Rhesusaffe (K–N) Embryonen. Beachten Sie die Beschriftung der zweiten meiotischen Spindel in m. F, M) Pfeile zeigen auf die mitochondriale Hülle der Spermien. Die Anwesenheit von unkonjugiertem Ubiquitin und/oder ubiquitinierten Substraten im Zytosol ist höchstwahrscheinlich für die rote Hintergrundmarkierung im Eizytoplasma verantwortlich. Maßstabsleisten: F und h = 15 μm ich und ICH' = 2 μm J = 5 μm n und m = 10 μm. Vergrößerung für EIN, ×2000 B, ×1500 CE, ×1000 g, ×1000 J, ×500 K, ×750 L, ×250.

Der ultimative Mechanismus für die mitochondriale Zerstörung von Spermien nach der Ubiquitinierung könnte Proteasomen, Lysosomen oder beides umfassen. Obwohl der Ubiquitinierungsweg typischerweise mit einer Proteasom-vermittelten Proteolyse verbunden ist [ 20], wies keiner der 17 Proteasom-spezifischen Antikörper (Affinity) Proteasomen in Verbindung mit den eingebauten Rinder-Sperma-Mitochondrien nach (nicht gezeigt). Im Gegensatz dazu zeigte die elektronenmikroskopische Analyse reichlich lysosomale Vakuolen und multivesikulierte Körper, die die eingebauten mitochondrialen Hüllen der Spermien umgeben ( Abb. 2, A–E). Dieser Befund wurde durch die Markierung befruchteter Eier mit dem lebenswichtigen lysosomalen Farbstoff LysoTracker DND 99 weiter unterstützt ( Abb. 2F). Zehn Millimol NH4Cl, ein lysosomotropes Mittel, verhinderte die Zerstörung der Spermienmitochondrien in allen achtzelligen Embryonen, die in zwei Experimenten gescreent wurden ( 2G ), wenn die Oozyten 20 Stunden nach der Insemination mit der Verbindung behandelt wurden ( 2H wurden insgesamt 214 Embryonen untersucht). Verklumpte Überreste der fluoreszierenden mitochondrialen Membranen wurden bei 25 % der achtzelligen Kontrollembryonen gefunden, verglichen mit den Spermienschwänzen, die bei 100 % der mit NH . behandelten Embryonen gefunden wurden4Cl ( Fig. 2H).

Zerstörung der Spermienschwanzmitochondrien bei homologen Rinderembryonen (A–K) und bei Interspezies-Kreuzungen zwischen Hauskühen und Gaurbullen (L–N). Elektronenmikroskopische Aufnahmen (A–E) zeigen einen intakten Spermaschwanz (EIN) im frühen Stadium der zygotischen Entwicklung (ca. 8 h nach der Befruchtung) und die zerfallenden Spermienschwänze (SEIN) umgeben von Lysosomen (Pfeile) und multivesikulierten Körpern (Pfeilspitzen) 20 h nach der Befruchtung. Lysosomen, die mit einer lebenswichtigen Sonde LysoTracker (Pfeilspitzen) markiert sind, sind mit Spermienmitochondrien im zygotischen Zytoplasma (F). Persistenz einer intakten mitochondrialen Spermienhülle (Pfeil) in einem achtzelligen Embryo, der sich in Gegenwart von 10 mM Lysosom-Antagonist NH . entwickelte4Cl (g) und das Diagramm zur Veranschaulichung der Persistenz von Spermienschwänzen in Rinderembryonen, die in Gegenwart dieses Wirkstoffs kultiviert wurden (H, n = 214). Die Rate der einzelligen Embryonen, die den Spermienschwanz enthalten, beträgt weniger als 100 %, da diese Gruppe die Eizellen umfasst, die 48 Stunden nach der Insemination unbefruchtet blieben. Mitochondriale Spermienscheiden (Pfeile) waren in Metaphase-II-arrestierten Zygoten vorhanden (Ich, J) befruchtet 1 h nach der Mikroinjektion des Anti-Ubiquitin-Antikörpers MK-12-3 und fixiert 50 h nach der Befruchtung (ein Stadium, das 8- bis 16-zelligen Embryonen unter Kontrollbedingungen entspricht), während die Kontrolle scheininjizierte Embryonen (K) waren frei von Spermienmitochondrien. Spermamitochondrien (Pfeile) persistierten im Zytoplasma der Embryonen aus Interspezies-Kreuzungen zwischen Hausrind und Gaur (L–N). L, M, und n) Zwei-, vier- und achtzellige Embryonen. Maßstabsleisten: EIN = 1 μm B = 500 nm C–E = 200 nm g = 15 μm n, ich, und K–M = 20 μm. F) Vergrößerung ×1200. J) Vergrößerung ×1000

Zerstörung der Spermienschwanzmitochondrien bei homologen Rinderembryonen (A–K) und bei Interspezies-Kreuzungen zwischen Hauskühen und Gaurbullen (L–N). Elektronenmikroskopische Aufnahmen (A–E) zeigen einen intakten Spermaschwanz (EIN) im frühen Stadium der zygotischen Entwicklung (ca. 8 h nach der Befruchtung) und die zerfallenden Spermienschwänze (SEIN) umgeben von Lysosomen (Pfeile) und multivesikulierten Körpern (Pfeilspitzen) 20 h nach der Befruchtung. Lysosomen, die mit einer lebenswichtigen Sonde LysoTracker (Pfeilspitzen) markiert sind, sind mit Spermienmitochondrien im zygotischen Zytoplasma (F). Persistenz einer intakten mitochondrialen Spermienhülle (Pfeil) in einem achtzelligen Embryo, der sich in Gegenwart von 10 mM Lysosom-Antagonist NH . entwickelte4Cl (g) und das Diagramm zur Veranschaulichung der Persistenz von Spermienschwänzen in Rinderembryonen, die in Gegenwart dieses Wirkstoffs kultiviert wurden (H, n = 214). Die Rate der einzelligen Embryonen, die den Spermienschwanz enthalten, beträgt weniger als 100 %, da diese Gruppe die Eizellen umfasst, die 48 Stunden nach der Insemination unbefruchtet blieben. Mitochondriale Spermienscheiden (Pfeile) waren in Metaphase-II-arrestierten Zygoten vorhanden (Ich, J) befruchtet 1 h nach der Mikroinjektion des Anti-Ubiquitin-Antikörpers MK-12-3 und fixiert 50 h nach der Befruchtung (ein Stadium, das 8- bis 16-zelligen Embryonen unter Kontrollbedingungen entspricht), während die Kontrolle scheininjizierte Embryonen (K) waren frei von Spermienmitochondrien. Spermamitochondrien (Pfeile) persistierten im Zytoplasma der Embryonen aus Interspezies-Kreuzungen zwischen Hausrind und Gaur (L–N). L, M, und n) Zwei-, vier- und achtzellige Embryonen. Maßstabsleisten: EIN = 1 μm B = 500 nm C–E = 200 nm g = 15 μm n, ich, und K–M = 20 μm. F) Vergrößerung ×1200. J) Vergrößerung ×1000

Eine Mikroinjektion des Anti-Ubiquitin-Antikörpers MK-12-3 in Kuh-Oozyten vor der Insemination wurde versucht, um die Zerstörung der Spermienmitochondrien zu blockieren. Wie erwartet blockierten diese Mikroinjektionen den Austritt befruchteter Eizellen aus dem Metaphase-II-Arrest, vermutlich durch Blockierung der Cyclin-Zerstörung durch Ubiquitin [15]. In den meisten Fällen verhinderte die Antikörperinjektion auch die Zerstörung der Spermienmitochondrien, was zu triploiden Metaphasenplatten führte, die von einer Spermienmitochondrienscheide flankiert wurden, die erst 40 h p.i. ( Fig. 2, I und J), wohingegen die scheininjizierten Kontroll-Oozyten das Vier- bis Acht-Zell-Stadium erreichten und die Spermienmitochondrien verloren ( Fig. 2K). Es ist jedoch nicht klar, ob diese Blockierung der mitochondrialen Zerstörung direkt durch die Bindung der injizierten Antikörper an die ubiquitinierten Epitope in den Spermienmitochondrien verursacht wurde oder indirekt durch die Blockierung der Zellzyklusprogression, die die Aktivierung von Ubiquitin und lysosomaler Maschinerie kontrollieren könnte während der Befruchtung. Bemerkenswerterweise persistieren väterliche Mitochondrien und mtDNA in den Interspezies-Kreuzungen, ein Phänomen, das zuvor bei Maushybriden dokumentiert wurde [ 13, 33]. Wenn Eizellen der Hauskuh (Bos Stier) wurden mit dem Sperma des asiatischen Rindes Gaur (Bos gaurus), wurde Ubiquitin auf den Gaur-Spermien-Mitochondrien, die in die resultierenden Hybridembryonen eingebaut waren, nicht nachgewiesen, obwohl der Antikörper MK-12-3 mit Gaur-Spermien-Ubiquitin (nicht gezeigt) kreuzreagiert. Darüber hinaus wurden die fast intakten Spermienschwänze in zweizelligen ( 2N ), vierzelligen ( 2M ) und 8- bis 16-zelligen Hybridembryonen ( 2N ) gefunden. Unsere vorläufigen Daten bestätigten diese Beobachtungen durch den Nachweis von Gaur-mtDNA in hybriden achtzelligen Embryonen unter Verwendung einer hochempfindlichen, väterlichen mtDNA-spezifischen Nested-PCR (unveröffentlichte Daten).

Mitochondriale Ubiquitinierung von Spermien während der Spermatogenese

Das Ubiquitin-Signal scheint in den Mitochondrien von Bullensperma vor der IVF vorhanden zu sein, obwohl seine Intensität so gering ist, dass es nur durch Fluoreszenzamplifikation mit Avidin-Biotin-Konjugaten nachgewiesen werden kann (siehe Materialen und Methoden) oder durch Western-Blotting. Zahlreiche ubiquitinierte Banden wurden durch Western-Blot-Analyse beweglicher Spermien nach Reduktion der Disulfidbindung ( 3A ) aufgedeckt, während unter nicht-reduzierenden Bedingungen nur wenige Banden vorhanden waren (siehe 3C). Spermaschwänze und -köpfe, die durch Beschallung getrennt wurden, zeigten einige gemeinsame und einige unterschiedliche ubiquitinierte Banden (Abb. 3B), was darauf hindeutet, dass sich einige der ubiquitinierten Substrate im Spermakopf, möglicherweise die Histone H2A [34, 35] und Histon H3 [36], von unterscheiden die im Spermaschwanz. Die Präabsorption des Ubiquitin-Antikörpers mit gereinigtem Rindererythrozyten-Ubiquitin eliminierte jegliche Kreuzreaktivität in Western-Blots von Bullenspermaextrakten ( 3C ). Durch Immunfluoreszenz wurde die mitochondriale Ubiquitinierung von Spermien durch Biotin-Streptavidin-Amplifikation in den Spermien von Caput epididymis ( 3E ) aber nicht in denen von Corpus und Cauda epididymis (nicht gezeigt) nachgewiesen. Positive Ergebnisse (Abb. 3D) wurden auch nach der Dekondensation ejakulierter Spermien in vitro mit 10 mM Dithiothreitol (DTT) erhalten [28, 37], was darauf hindeutet, dass die mitochondriale Ubiquitinierung der Spermien im männlichen Reproduktionstrakt beginnt und die ubiquitinierten Epitope durch Disulfidbindungsvernetzung, die während der Nebenhodenpassage auftritt [ 38]. Zusätzlich zu den Mitochondrien von Bullensperma wurde Ubiquitin durch Immunfluoreszenz in der mitochondrialen Hülle von Mäusen ( 3F ), ​​Rhesusaffen ( 3G) und menschlichen Spermien ( 3H ) nachgewiesen. Eine Reduktionsbehandlung war nicht erforderlich, um Ubiquitin in Spermien dieser Spezies nachzuweisen. Bei Rhesus-Spermien war die auffälligste Markierung im Verbindungsstück zu sehen, wo sich das Spermienzentriol befindet. Dieser Befund steht im Einklang mit der bekannten Assoziation von Ubiquitin mit dem Zentrosom der Körperzelle [ 39] sowie mit der Reduktion des Zentrosoms während der Spermatogenese (Übersicht in [ 40]).

Nachweis der ubiquitinierten Substrate in Bullen (A–E), Maus (F), Rhesus (g) und Mensch (h) Sperma. Western-Blot der beweglichen Bullenspermafraktion mit Anti-Ubiquitin-Antikörper MK-12-3 (EIN) zeigt mehrere ubiquitinierte Substrate. Western Blot von Spermienköpfen (B, Spur 1) und Schwänze (B, Spur 2), die durch Beschallung von Bullensperma isoliert wurde, zeigt die prominenten ubiquitinierten Banden von 80 kDa und ∼ 50 kDa, die überwiegend in den Kopf- bzw. Schwanzfraktionen gefunden werden. Einige der ubiquitinierten Substrate können während der Trennung und Fraktionierung verloren gegangen oder reduziert worden sein, während Kreuzkontaminationen nicht vollständig ausgeschlossen werden können. Kontrollblot für Antikörperspezifität (C), unter Verwendung ganzer Spermienproben, die unter nicht-reduzierenden (Spuren 2, 4) und reduzierenden (Spuren 3, 5) Bedingungen und Antikörper MK-12-3 präabsorbiert mit gereinigtem Rindererythrozyten-Ubiquitin (C Bahnen 2, 3) oder unbehandeltes MK-12-3 (C Bahnen 4, 5). Spur 1 zeigt Molekulargewichtsmarker. Nachweis von Ubiquitin (grün) mit Antikörper MK-12-3, amplifiziert durch Streptavidin-Biotin-Reaktion in ejakulierten Bullenspermien, die mit 10 mM DTT behandelt wurden (D) und in den unbehandelten Spermien von Caput epididymis (E) werden gezeigt. Der Nachweis von Ubiquitin durch ein einfaches, zweistufiges Verfahren ohne Reduktion der Behandlung wird in der Maus gezeigt (F), Rhesus (g) und Mensch (h) Sperma. Kern-DNA in allen Spermienproben wurde mit DAPI gegengefärbt. Balken = 5 μm

Nachweis der ubiquitinierten Substrate in Bullen (A–E), Maus (F), Rhesus (g) und Mensch (h) Sperma. Western Blot der beweglichen Bullenspermafraktion mit dem Anti-Ubiquitin-Antikörper MK-12-3 (EIN) zeigt mehrere ubiquitinierte Substrate. Western Blot von Spermienköpfen (B, Spur 1) und Schwänze (B, Spur 2), die durch Beschallung von Bullensperma isoliert wurde, zeigt die prominenten ubiquitinierten Banden von 80 kDa und ∼ 50 kDa, die überwiegend in den Kopf- bzw. Schwanzfraktionen gefunden werden. Einige der ubiquitinierten Substrate können während der Trennung und Fraktionierung verloren gegangen oder reduziert worden sein, während Kreuzkontaminationen nicht vollständig ausgeschlossen werden können. Kontrollblot für Antikörperspezifität (C), unter Verwendung ganzer Spermienproben, die unter nicht-reduzierenden (Spuren 2, 4) und reduzierenden (Spuren 3, 5) Bedingungen und Antikörper MK-12-3 präabsorbiert mit gereinigtem Rindererythrozyten-Ubiquitin (C Bahnen 2, 3) oder unbehandeltes MK-12-3 (C Bahnen 4, 5). Spur 1 zeigt Molekulargewichtsmarker. Nachweis von Ubiquitin (grün) mit Antikörper MK-12-3, amplifiziert durch Streptavidin-Biotin-Reaktion in ejakulierten Bullenspermien, die mit 10 mM DTT behandelt wurden (D) und in den unbehandelten Spermien von Caput epididymis (E) werden gezeigt. Der Nachweis von Ubiquitin durch ein einfaches, zweistufiges Verfahren ohne Reduktion der Behandlung wird in der Maus gezeigt (F), Rhesus (g) und Mensch (h) Sperma. Kern-DNA in allen Spermienproben wurde mit DAPI gegengefärbt. Balken = 5 μm

Während der Spermatogenese wurde die mitochondriale Ubiquitinierung mittels Biotin-Streptavidin-Amplifikation bereits im sekundären Spermatozytenstadium (Abb. 4A), dann in runden Spermatiden (Abb. 4B), verlängerten Spermatiden (Abb. 4C) und in vollständig differenzierten Hodenspermatozoen nachgewiesen von Stier (Abb. 4D). Ubiquitinierte Mitochondrien wurden auch in den Spermienrestkörpern gefunden ( Abb. 4E). In den begleitenden Stadien der Spermatogenese konnten wir das Ubiquitin-konjugierende Enzym E2 nachweisen, das zunächst als Kombination von punktförmigen und diffusen zytoplasmatischen Färbungen um die Mitochondrien in sekundären Spermatozyten auftritt ( Abb. 4F) und später in die Akrosomen wandert Kappe in runden und verlängerten Spermatiden ( Abb. 4, G und H). Enzym E2 ist in reifen Hodenspermatozoen nicht mehr nachweisbar ( Abb. 4I), obwohl es in den Restkörpern noch nachweisbar ist ( Abb. 4J).

Ubiquitinierung der Mitochondrien in boviner spermatogener Zelllinie. A–E) Kolokalisation von Ubiquitin (grün) mit den Mitochondrien (rot) in sekundären Spermatozyten (EIN), runde Spermatiden (B), verlängerte Spermatiden (C), voll differenzierte Hodenspermatozoen (D) und verworfene Restkörper (E). F–J) Lokalisierung des Ubiquitin-konjugierenden Enzyms E2 in den entsprechenden Stadien der Bullen-Spermatogenese. E2-Markierung (grün) komplementiert das mitochondriale Signal im Zytoplasma eines sekundären Spermatozyten (F) und im restlichen zytoplasmatischen Tröpfchen (J). Beachten Sie die Sequestrierung von E2 im sich entwickelnden Akrosom der Runde (g) und Verlängerung (h) Spermatiden und der vollständige Verlust der E2-Kreuzreaktivität der vollständig differenzierten Hodenspermatozoen (ich). Spermatogene Zellen wurden isoliert, mit MitoTracker CMTM Ros (rot) markiert und mit dem Anti-Ubiquitin-Antikörper MK-12-3 (grün in .) für die Immunfluoreszenz aufbereitet A–E) amplifiziert durch Avidin-Biotin-Reaktion oder mit dem Anti-E2-Antikörper (grün in F–J) durch ein einfaches zweistufiges Verfahren. DNA (blau) wurde mit DAPI bar = 5 µm gefärbt. Die Ubiquitinierung der Mitochondrien wird in spermatogenen Zellen von Bullen gezeigt. Kolokalisation von Ubiquitin (grün) mit den Mitochondrien (rot) in sekundären Spermatozyten (EIN), runde Spermatiden (B), verlängerte Spermatiden (C), voll differenzierte Hodenspermatozoen (D) und abgestoßene zytoplasmatische Tröpfchen mit verworfenen Mitochondrien (E). Balken = 5 μm

Ubiquitinierung der Mitochondrien in boviner spermatogener Zelllinie. A–E) Kolokalisation von Ubiquitin (grün) mit den Mitochondrien (rot) in sekundären Spermatozyten (EIN), runde Spermatiden (B), verlängerte Spermatiden (C), voll differenzierte Hodenspermatozoen (D) und verworfene Restkörper (E). F–J) Lokalisierung des Ubiquitin-konjugierenden Enzyms E2 in den entsprechenden Stadien der Bullen-Spermatogenese. E2-Markierung (grün) komplementiert das mitochondriale Signal im Zytoplasma eines sekundären Spermatozyten (F) und im restlichen zytoplasmatischen Tröpfchen (J). Beachten Sie die Sequestrierung von E2 im sich entwickelnden Akrosom der Runde (g) und Verlängerung (h) Spermatiden und der vollständige Verlust der E2-Kreuzreaktivität der vollständig differenzierten Hodenspermatozoen (ich). Spermatogene Zellen wurden isoliert, mit MitoTracker CMTM Ros (rot) markiert und mit dem Anti-Ubiquitin-Antikörper MK-12-3 (grün in .) für die Immunfluoreszenz aufbereitet A–E) amplifiziert durch Avidin-Biotin-Reaktion oder mit dem Anti-E2-Antikörper (grün in F–J) durch ein einfaches zweistufiges Verfahren. DNA (blau) wurde mit DAPI bar = 5 µm gefärbt. Die Ubiquitinierung der Mitochondrien wird in spermatogenen Zellen von Bullen gezeigt. Kolokalisation von Ubiquitin (grün) mit den Mitochondrien (rot) in sekundären Spermatozyten (EIN), runde Spermatiden (B), verlängerte Spermatiden (C), voll differenzierte Hodenspermatozoen (D) und abgestoßene zytoplasmatische Tröpfchen mit verworfenen Mitochondrien (E). Balken = 5 μm

Nachweis von Prohibitin, einem Kandidaten-Ubiquitin-Substrat, in Mitochondrien von Bullensperma. EIN) Western-Blotting von Spermienextrakten mit Anti-Prohibitin-Antikörper RB-292 (Spur 1). Der Blot wurde gestrippt und mit dem Anti-Ubiquitin-Antikörper MK-12-3 (Spur 2) erneut sondiert. Beachten Sie, dass sich die doppelte hochmolekulare Bande in Spur 1, aber nicht die gemeinsame 30-kDa-Prohibitin-Bande (Sternchen) mit den ubiquitinierten Banden in Spur 2 überlappt (Doppelpfeile). B) Immunfluoreszenz-Nachweis von Prohibitin in Bullenspermien, die mit 10 mM DTT vorbehandelt wurden. Maßstabsbalken = 5 μM

Nachweis von Prohibitin, einem Kandidaten-Ubiquitin-Substrat, in Mitochondrien von Bullensperma. EIN) Western-Blotting von Spermienextrakten mit Anti-Prohibitin-Antikörper RB-292 (Spur 1). Der Blot wurde gestrippt und mit dem Anti-Ubiquitin-Antikörper MK-12-3 (Spur 2) erneut sondiert. Beachten Sie, dass die doppelte hochmolekulare Bande in Spur 1, jedoch nicht die gemeinsame 30-kDa-Prohibitin-Bande (Sternchen), mit den ubiquitinierten Banden in Spur 2 überlappt (Doppelpfeile). B) Immunfluoreszenz-Nachweis von Prohibitin in Bullenspermien, die mit 10 mM DTT vorbehandelt wurden. Maßstabsbalken = 5 μM

Wir haben eines der potentiellen ubiquitinierten mitochondrialen Substrate von Spermien als Prohibitin identifiziert, ein evolutionär konserviertes 30-kDa-integriertes Protein der inneren mitochondrialen Membran [ 41]. In Western-Blots von SDS-reduzierten Bullenspermaextrakten kreuzreagierten zwei verschiedene Anti-Prohibitin-Antikörper mit der erwarteten Bande von 30 kDa sowie mit zwei Banden mit höherem Molekulargewicht ( 5A , Spur 1). Diese beiden Banden scheinen ubiquitiniert zu sein, wie durch Strippen und Neumarkieren eines Prohibitin-Gels mit Anti-Ubiquitin-Antikörpern gezeigt wurde ( 5A , Spur 2). Ähnlich wie bei Ubiquitin konnten wir Prohibitin in den Mitochondrien reifer Bullensperma nur nach Disulfidbindungsreduktion mit 10 mM DTT nachweisen (Abb. 5B).


Für Schüler und Lehrer

Nur für Lehrer

DAUERHAFTES VERSTEHEN
IST-1
Erbliche Informationen sorgen für die Kontinuität des Lebens.

LERNZIEL
IST-1.J
Erklären Sie Abweichungen von Mendels Modell der Vererbung von Merkmalen.

WESENTLICHES WISSEN
IST-1.J.1
Vererbungsmuster vieler Merkmale folgen nicht den durch die Mendelschen Gesetze vorhergesagten Verhältnissen und können durch quantitative Analyse identifiziert werden, wobei beobachtete phänotypische Verhältnisse sich statistisch von den vorhergesagten Verhältnissen unterscheiden —

  1. Gene, die auf demselben Chromosom benachbart und nahe beieinander liegen, können genetisch verknüpft erscheinen. Die Wahrscheinlichkeit, dass genetisch verknüpfte Gene als eine Einheit segregieren, kann verwendet werden, um den Kartenabstand zwischen ihnen zu berechnen.

IST-1.J.2
Einige Merkmale werden durch Gene auf den Geschlechtschromosomen bestimmt und werden als geschlechtsgebundene Merkmale bezeichnet. Das Vererbungsmuster von geschlechtsgebundenen Merkmalen kann oft aus Daten vorhergesagt werden, einschließlich des Stammbaums, der den Genotyp/Phänotyp der Eltern und die Genotypen/Phänotypen der Nachkommen anzeigt.

IST-1.J.3
Viele Merkmale sind das Produkt mehrerer Gene und/oder physiologischer Prozesse, die in Kombination wirken, diese Merkmale trennen sich daher nicht in Mendelschen Mustern.

IST-1.J.4
Einige Merkmale resultieren aus nichtnuklearer Vererbung —

  1. Chloroplasten und Mitochondrien werden nach dem Zufallsprinzip nach Gameten und Tochterzellen sortiert, daher folgen Merkmale, die durch Chloroplasten und mitochondriale DNA bestimmt werden, nicht den einfachen Mendelschen Regeln.
  2. Bei Tieren werden Mitochondrien durch die Eizelle und nicht durch Spermien als solche übertragen, Merkmale, die durch die mitochondriale DNA bestimmt werden, werden mütterlicherseits vererbt.
  3. Bei Pflanzen werden Mitochondrien und Chloroplasten in der Eizelle und nicht im Pollen selbst übertragen, Mitochondrien- und Chloroplasten-bestimmte Merkmale werden mütterlicherseits vererbt.

Evolutionäre Spermienbiologie und Ökologie

THEORIE. Wir haben unser ‘manifest’ of . vorgestellt Spermienökologie als neuartiges biologisches Konzept zur Untersuchung von Samenzellen (Reinhardt et al. 2015). Darin präsentieren wir überwältigende Beweise dafür, dass die Spermienfunktion durch die Umwelt verändert wird, und fordern die evolutionäre und ökologische Forschung auf, die Umwelteinflüsse auf Spermien nicht zu vernachlässigen. Dies betrifft die männliche, weibliche und unmittelbare Spermienumgebung, es betrifft äußere und innere Düngemittel sowie terrestrische und aquatische Lebensräume. Wir glauben, dass die umfangreichen Beweise für die phänotypische Plastizität von Spermien eine Neubewertung einiger evolutionärer Annahmen in der Spermienkonkurrenztheorie rechtfertigen, parallel zu unserer empirischen Studie, die keine Vererbbarkeit der Spermienkonkurrenzfähigkeit zeigt (Dobler & Reinhardt 2016). Es gibt Interaktionseffekte zwischen Genotyp und Umgebung auf die Spermienfunktion, aber ihre allgemeine adaptive Bedeutung (z. B. lokale Anpassung) bedarf weiterer Forschung. Unter anderem ungelöste Probleme sind ob Spermiendiversifikation tritt durch natürliche Selektion auf, die direkt auf die Spermienfunktion oder auf die männliche und weibliche Mikroumgebung einwirkt, die die plastische Leistung der Spermien optimiert (für die wir den Begriff ‘ . geprägt haben).Sperma Nischen‘).

Wir haben auch einen vergleichenden Ansatz zum Spermienmetabolismus beim Mann gewählt und verschiedene Arten von untersucht Drosophila dass der Spermienstoffwechsel beim Männchen die Wiederpaarungsrate der Weibchen erklärt.

Turnell BR, Reinhardt K. Die Stoffwechselrate der Spermien prognostiziert die Paarungshäufigkeit der Frau Drosophila Spezies. Bald kommt ….

Reinhardt K, Dobler R, Abbott JK. 2015. Eine Ökologie von Spermien. Spermiendiversifikation durch natürliche Selektion. Jahresberichte zu Ökologie, Evolution und Systematik im Jahr 2016. Link

Dobler R, Reinhardt K. 2016. Heritabilität, Evolvierbarkeit, phänotypische Plastizität und zeitliche Variation des Spermienwettbewerbserfolgs von Drosophila melanogaster. Zeitschrift für Evolutionsbiologie 29: 929-941. Verknüpfung

Otti O, Johnston PR, Horsburgh G, Galindo J, Reinhardt K. 2015. Weibliche transkriptomische Reaktion auf männliche genetische und nichtgenetische Ejakulatvariation. Verhaltensökologie, Verknüpfung


Gesundheitszustände im Zusammenhang mit Chromosomenveränderungen

Die folgenden chromosomalen Zustände sind mit Veränderungen in der Struktur oder Anzahl der Kopien der mitochondrialen DNA verbunden.

Altersbedingter Hörverlust

Veränderungen der mitochondrialen DNA gehören zu den am besten untersuchten genetischen Faktoren im Zusammenhang mit altersbedingtem Hörverlust. Diese Form des Hörverlustes entwickelt sich mit zunehmendem Alter und kann bereits ab dem 30. oder 40. Lebensjahr beginnen. Es betrifft typischerweise beide Ohren und verschlechtert sich im Laufe der Zeit allmählich, wodurch es schwierig wird, Sprache zu verstehen und andere Geräusche zu hören. Dieser Zustand resultiert aus einer Kombination von genetischen, Umwelt- und Lebensstilfaktoren, von denen viele nicht identifiziert wurden.

Mit zunehmendem Alter sammelt die mitochondriale DNA schädliche Mutationen an, einschließlich Deletionen und anderer Veränderungen. Dieser Schaden resultiert aus einer Ansammlung schädlicher Moleküle, die als reaktive Sauerstoffspezies bezeichnet werden und die Nebenprodukte der Energieproduktion in den Mitochondrien sind. Mitochondriale DNA ist besonders anfällig, da sie eine begrenzte Fähigkeit hat, sich selbst zu reparieren. Infolgedessen schädigen reaktive Sauerstoffspezies leicht die mitochondriale DNA, was zu Fehlfunktionen der Zellen und schließlich zum Absterben führt. Zellen mit hohem Energiebedarf, beispielsweise im Innenohr, die für das Hören kritisch sind, reagieren besonders empfindlich auf die Auswirkungen mitochondrialer DNA-Schäden. Dieser Schaden kann die Funktion des Innenohrs irreversibel verändern und zu Hörverlust führen.

Syndrom des zyklischen Erbrechens

Einige Fälle des zyklischen Erbrechens, insbesondere solche, die in der Kindheit beginnen, können mit Veränderungen der mitochondrialen DNA zusammenhängen. Diese Störung verursacht wiederkehrende Episoden von Übelkeit, Erbrechen und Müdigkeit (Lethargie). Einige der genetischen Veränderungen verändern einzelne DNA-Bausteine ​​(Nukleotide), während andere größere Abschnitte der mitochondrialen DNA neu anordnen. Diese Veränderungen beeinträchtigen wahrscheinlich die Fähigkeit der Mitochondrien, Energie zu produzieren. Forscher spekulieren, dass die beeinträchtigten Mitochondrien bestimmte Zellen des autonomen Nervensystems beeinflussen können, das ist der Teil des Nervensystems, der unwillkürliche Körperfunktionen wie Herzfrequenz, Blutdruck und Verdauung steuert. Es bleibt jedoch unklar, wie diese Veränderungen die wiederkehrenden Episoden verursachen könnten, die für das Syndrom des zyklischen Erbrechens charakteristisch sind.

Cytochrom-c-Oxidase-Mangel

Mutationen in mindestens drei mitochondrialen Genen können Cytochrom verursachen C Oxidasemangel, ein Zustand, der mehrere Teile des Körpers betreffen kann, einschließlich der Bewegungsmuskulatur (Skelettmuskulatur), des Herzens, des Gehirns oder der Leber.

Die mitochondrialen Gene, die mit Cytochrom assoziiert sind C Oxidase-Mangel liefert Anweisungen zur Herstellung von Proteinen, die Teil einer großen Enzymgruppe (Komplex) namens Cytochrom sind C Oxidase (auch bekannt als Komplex IV). Cytochrom C Oxidase ist für den letzten Schritt der oxidativen Phosphorylierung vor der Bildung von ATP verantwortlich. Die mtDNA-Mutationen, die diesen Zustand verursachen, verändern die Proteine, aus denen Cytochrome bestehen C Oxidase. Dadurch wird Cytochrom C Oxidase kann nicht funktionieren. Ein Mangel an funktionellem Cytochrom C Oxidase stört die oxidative Phosphorylierung, was zu einer Abnahme der ATP-Produktion führt. Forscher glauben, dass eine gestörte oxidative Phosphorylierung zum Zelltod in Geweben führen kann, die große Mengen an Energie benötigen, wie Gehirn, Muskeln und Herz. Der Zelltod in diesen und anderen empfindlichen Geweben trägt wahrscheinlich zu den Merkmalen des Cytochrom-c-Oxidase-Mangels bei.

Kearns-Sayre-Syndrom

Die meisten Menschen mit Kearns-Sayre-Syndrom haben eine einzelne, große Deletion der mitochondrialen DNA. Die Deletionen reichen von 1.000 bis 10.000 Nukleotiden, und die häufigste Deletion beträgt 4.997 Nukleotide. Das Kearns-Sayre-Syndrom betrifft hauptsächlich die Augen und verursacht eine Schwäche der Augenmuskulatur (Ophthalmoplegie) und einen Abbau des lichtempfindlichen Gewebes im Augenhintergrund (Retinopathie). Die mitochondrialen DNA-Deletionen führen zum Verlust von Genen, die Proteine ​​​​produzieren, die für die oxidative Phosphorylierung erforderlich sind, was zu einer Abnahme der zellulären Energieproduktion führt. Die Forscher haben nicht festgestellt, wie diese Deletionen zu den spezifischen Anzeichen und Symptomen des Kearns-Sayre-Syndroms führen, obwohl die Merkmale der Erkrankung wahrscheinlich mit einem Mangel an zellulärer Energie zusammenhängen. Es wurde vermutet, dass Augen häufig von mitochondrialen Defekten betroffen sind, da sie besonders von Mitochondrien für Energie abhängig sind.

Leber hereditäre Optikusneuropathie

Mutationen in vier mitochondrialen Genen, MT-ND1, MT-ND4, MT-ND4L, und MT-ND6, wurden bei Menschen mit Leber hereditärer Optikusneuropathie identifiziert. Diese Gene liefern Anweisungen zur Herstellung von Proteinen, die Teil eines großen Enzymkomplexes sind. Dieses Enzym, bekannt als Komplex I, ist für die oxidative Phosphorylierung notwendig. Die Mutationen, die für die Leber hereditäre Optikusneuropathie verantwortlich sind, verändern einzelne Aminosäuren in diesen Proteinen, was die Bildung von ATP in den Mitochondrien beeinflussen kann. Es bleibt jedoch unklar, warum die Auswirkungen dieser Mutationen oft auf den Nerv beschränkt sind, der visuelle Informationen vom Auge an das Gehirn weiterleitet (der Sehnerv). Weitere genetische und umweltbedingte Faktoren tragen wahrscheinlich zum Verlust des Sehvermögens und zu den anderen medizinischen Problemen bei, die mit der Leberschen hereditären Optikusneuropathie verbunden sind.

Leigh-Syndrom

Mutationen in einem von mehreren verschiedenen mitochondrialen Genen können das Leigh-Syndrom verursachen, eine fortschreitende Erkrankung des Gehirns, die normalerweise im Säuglings- oder Kleinkindalter auftritt. Bei betroffenen Kindern kann es zu Entwicklungsverzögerungen, Muskelschwäche, Bewegungsproblemen oder Atembeschwerden kommen.

Einige der mit dem Leigh-Syndrom assoziierten Gene liefern Anweisungen zur Herstellung von Proteinen, die Teil der großen Enzymkomplexe sind, die für die oxidative Phosphorylierung erforderlich sind. Zum Beispiel das am häufigsten mutierte mitochondriale Gen beim Leigh-Syndrom, MT-ATP6, enthält Anweisungen für ein Protein, das einen Teil des Komplexes V bildet, ein wichtiges Enzym bei der oxidativen Phosphorylierung, das in den Mitochondrien ATP erzeugt. Die anderen Gene liefern Anweisungen zur Herstellung von tRNA-Molekülen, die für die Proteinproduktion in den Mitochondrien unerlässlich sind. Viele dieser Proteine ​​spielen eine wichtige Rolle bei der oxidativen Phosphorylierung. Die mitochondrialen Genmutationen, die das Leigh-Syndrom verursachen, beeinträchtigen die oxidative Phosphorylierung. Obwohl der Mechanismus unklar ist, wird angenommen, dass eine beeinträchtigte oxidative Phosphorylierung in empfindlichen Geweben zum Zelltod führen kann, was die Anzeichen und Symptome des Leigh-Syndroms verursachen kann.

Mütterlich vererbter Diabetes und Taubheit

Mutationen in mindestens drei mitochondrialen Genen, MT-TL1, MT-TK, und MT-TE, kann mitochondrialen Diabetes und Taubheit (MIDD) verursachen. Menschen mit dieser Erkrankung haben Diabetes und manchmal einen Hörverlust, insbesondere bei hohen Tönen. Die MT-TL1, MT-TK, und MT-TE Gene liefern Anweisungen für die Herstellung von tRNA-Molekülen, die für die Proteinproduktion in den Mitochondrien unerlässlich sind. In bestimmten Zellen der Bauchspeicheldrüse (Beta-Zellen) helfen Mitochondrien bei der Überwachung des Blutzuckerspiegels. Als Reaktion auf hohe Zuckerspiegel helfen Mitochondrien, die Freisetzung eines Hormons namens Insulin auszulösen, das den Blutzuckerspiegel steuert. Die MT-TL1, MT-TK, und MT-TE Genmutationen im Zusammenhang mit MIDD verlangsamen die Proteinproduktion in Mitochondrien und beeinträchtigen deren Funktion. Forscher glauben, dass die Störung der mitochondrialen Funktion die Fähigkeit der Mitochondrien verringert, die Insulinfreisetzung auszulösen. Bei Menschen mit MIDD entsteht Diabetes, wenn die Betazellen nicht genug Insulin produzieren, um den Blutzucker effektiv zu regulieren. Forscher haben nicht festgestellt, wie Mutationen in diesen Genen zu Hörverlust führen.

Mangel an mitochondrialem Komplex III

Mutationen im MT-CYB Gen, das in der mitochondrialen DNA gefunden wird, kann einen Mangel an mitochondrialem Komplex III verursachen. Wenn die Erkrankung durch Mutationen in diesem Gen verursacht wird, ist die Erkrankung normalerweise durch Muskelschwäche (Myopathie) und Schmerzen gekennzeichnet, insbesondere während des Trainings (Bewegungsunverträglichkeit). Schwerer betroffene Personen können Probleme mit anderen Körpersystemen haben, einschließlich Leber, Nieren, Herz und Gehirn.

Die MT-CYB Gen liefert Anweisungen zur Herstellung eines Proteins namens Cytochrom b. Dieses Protein ist ein Bestandteil von Komplex III, einem von mehreren Komplexen, die eine oxidative Phosphorylierung durchführen. Die meisten MT-CYB Genmutationen, die am mitochondrialen Komplex III-Mangel beteiligt sind, verändern einzelne Aminosäuren im Cytochrom-b-Protein oder führen zu einem abnormal kurzen Protein. Diese Cytochrom-b-Veränderungen beeinträchtigen die Bildung von Komplex III, wodurch die Aktivität des Komplexes und die oxidative Phosphorylierung stark reduziert werden. Schäden an der Skelettmuskulatur oder anderen Geweben und Organen, die durch den Mangel an zellulärer Energie verursacht werden, führen zu den Merkmalen eines Mangels an mitochondrialem Komplex III.

Mitochondriale Enzephalomyopathie, Laktatazidose und schlaganfallähnliche Episoden

Mutationen in mindestens fünf mitochondrialen Genen, MT-ND1, MT-ND5, MT-TH, MT-TL1, und MT-TV, kann die charakteristischen Merkmale der mitochondrialen Enzephalomyopathie, Laktatazidose und Schlaganfall-ähnlichen Episoden (MELAS) verursachen. Einige dieser Gene liefern Anweisungen zur Herstellung von Proteinen, die Teil eines großen Enzymkomplexes sind, genannt Komplex I, der für die oxidative Phosphorylierung notwendig ist. Die anderen Gene liefern Anweisungen zur Herstellung von tRNA-Molekülen, die für die Proteinproduktion in den Mitochondrien unerlässlich sind.

Eine besondere Mutation in der MT-TL1 Gen verursacht mehr als 80 Prozent aller Fälle von MELAS. Diese Mutation, geschrieben als A3243G, ersetzt das Nukleotid Adenin durch das Nukleotid Guanin an Position 3243 im MT-TL1 Gen.

Die Mutationen, die MELAS verursachen, beeinträchtigen die Fähigkeit der Mitochondrien, Proteine ​​​​zu produzieren, Sauerstoff zu verwenden und Energie zu produzieren. Forscher haben nicht festgestellt, wie Veränderungen der mitochondrialen DNA zu den spezifischen Anzeichen und Symptomen von MELAS führen. Sie untersuchen weiterhin die Auswirkungen von mitochondrialen Genmutationen in verschiedenen Geweben, insbesondere im Gehirn.

Myoklonische Epilepsie mit zerlumpten roten Fasern

Mutationen in mindestens vier mitochondrialen Genen, MT-TK, MT-TL1, MT-TH, und MT-TS1, kann die Anzeichen und Symptome einer myoklonischen Epilepsie mit roten Fasern (MERRF) verursachen. Diese Gene liefern Anweisungen für die Herstellung von tRNA-Molekülen, die für die Proteinproduktion in den Mitochondrien unerlässlich sind.

Eine besondere Mutation in der MT-TK Gen verursacht mehr als 80 Prozent aller Fälle von MERRF. Diese Mutation, geschrieben als A8344G, ersetzt das Nukleotid Adenin durch das Nukleotid Guanin an Position 8344 im MT-TK Gen.

Mutationen im MT-TK, MT-TL1, MT-TH, und MT-TS1 Gene beeinträchtigen die Fähigkeit der Mitochondrien, Proteine ​​​​zu produzieren, Sauerstoff zu verwenden und Energie zu produzieren. Es bleibt unklar, wie Mutationen in diesen Genen zu Muskelproblemen und neurologischen Merkmalen von MERRF führen.

Neuropathie, Ataxie und Retinitis pigmentosa

Mutationen in einem mitochondrialen Gen, MT-ATP6, wurden bei Menschen mit Neuropathie, Ataxie und Retinitis pigmentosa (NARP) gefunden. Die MT-ATP6 Gen liefert Anweisungen zur Herstellung eines Proteins, das für die normale mitochondriale Funktion essentiell ist. Dieses Protein bildet einen Teil (Untereinheit) eines Enzyms namens ATP-Synthase. Dieses Enzym, das auch als Komplex V bekannt ist, ist für den letzten Schritt der oxidativen Phosphorylierung verantwortlich, bei dem ein Molekül namens Adenosindiphosphat (ADP) in ATP umgewandelt wird. Mutationen im MT-ATP6 Gen die Struktur oder Funktion der ATP-Synthase verändern und die Fähigkeit der Mitochondrien, ATP zu bilden, verringern. Es ist unklar, wie diese Unterbrechung der mitochondrialen Energieproduktion zu Muskelschwäche, Sehverlust und den anderen spezifischen Merkmalen von NARP führt.

Nicht-syndromaler Hörverlust

Mutationen in der mitochondrialen DNA sind mit einem nicht-syndromalen Hörverlust verbunden, d. h. einem Hörverlust, der nicht mit anderen Anzeichen und Symptomen verbunden ist. Diese Mutationen können in mindestens zwei mitochondrialen Genen auftreten: MT-RNR1 und MT-TS1.

Die MT-RNR1 Gen liefert Anweisungen zur Herstellung einer Art ribosomaler RNA namens 12S-RNA. Dieses Molekül hilft, Proteinbausteine, die als Aminosäuren bekannt sind, zu funktionierenden Proteinen zusammenzusetzen, die in den Mitochondrien eine oxidative Phosphorylierung durchführen. Mutationen in diesem Gen erhöhen das Risiko von Hörverlust, insbesondere bei Menschen, die verschreibungspflichtige Antibiotika, sogenannte Aminoglykoside, einnehmen. Diese Antibiotika werden typischerweise verwendet, um lebensbedrohliche und chronische bakterielle Infektionen wie Tuberkulose zu behandeln. Aminoglykoside töten Bakterien, indem sie sich an ihre ribosomale RNA binden und die Fähigkeit der Bakterien, Proteine ​​herzustellen, unterbrechen. Häufige genetische Veränderungen im MT-RNR1 Gen kann die 12S-RNA in menschlichen Zellen ähnlich der bakteriellen ribosomalen RNA aussehen lassen. Als Ergebnis können Aminoglykoside auf die veränderte 12S-RNA abzielen, genauso wie sie auf bakterielle ribosomale RNA abzielen. Das Antibiotikum bindet leicht an die abnormale 12S-RNA, was die Fähigkeit der Mitochondrien beeinträchtigt, Proteine ​​​​zu produzieren, die für die oxidative Phosphorylierung benötigt werden. Forscher glauben, dass diese unbeabsichtigte Wirkung von Aminoglykosiden die in den Mitochondrien produzierte ATP-Menge reduzieren, die Produktion schädlicher Nebenprodukte erhöhen und schließlich dazu führen kann, dass sich die Zelle selbst zerstört (Apoptose erleidet).

Die MT-TS1 Gen liefert Anweisungen zur Herstellung einer Form von tRNA, die als tRNASer (UCN) bezeichnet wird. Dieses Molekül hilft beim Zusammenbau von Aminosäuren zu funktionierenden Proteinen voller Länge. Die meisten MT-TS1-Genmutationen stören wahrscheinlich die normale Produktion des tRNASer (UCN)-Moleküls oder verändern seine Struktur. Dadurch steht weniger tRNASer (UCN) zur Verfügung, um Proteine ​​in den Mitochondrien zusammenzusetzen. Diese Veränderungen reduzieren die Produktion von Proteinen, die für die oxidative Phosphorylierung benötigt werden, was die Fähigkeit der Mitochondrien zur Herstellung von ATP beeinträchtigen kann.

Forscher haben nicht herausgefunden, warum die Auswirkungen von Mutationen in diesen Genen normalerweise auf Zellen im Innenohr beschränkt sind, die für das Hören wichtig sind. Andere genetische oder Umweltfaktoren spielen wahrscheinlich eine Rolle bei den Anzeichen und Symptomen, die mit diesen Mutationen verbunden sind.

Pearson-Syndrom

Wie beim Kearns-Sayre-Syndrom (oben beschrieben) verursacht die Deletion der mitochondrialen DNA das Pearson-Syndrom. Diese schwere Erkrankung beeinträchtigt die Entwicklung von Blutzellen und die Funktion der Bauchspeicheldrüse und anderer Organe und ist im Säuglings- oder Kleinkindalter oft tödlich. Die Größe und Lage der mitochondrialen DNA-Deletionen variiert und reicht normalerweise von 1.000 bis 10.000 Nukleotiden. Etwa 20 Prozent der Betroffenen haben eine Deletion von 4.997 Nukleotiden, diese genetische Veränderung ist auch beim Kearns-Sayre-Syndrom üblich. Der Verlust mitochondrialer DNA beeinträchtigt die oxidative Phosphorylierung, wodurch die den Zellen zur Verfügung stehende Energie reduziert wird. Es ist jedoch nicht bekannt, wie mitochondriale DNA-Deletionen zu den spezifischen Anzeichen und Symptomen des Pearson-Syndroms führen.

Es ist nicht klar, warum dieselbe Deletion zu unterschiedlichen Anzeichen und Symptomen führen kann. Forscher vermuten, dass die Gewebe, in denen die mitochondrialen DNA-Deletionen gefunden werden, bestimmen, welche Merkmale sich entwickeln. Einige Personen mit Pearson-Syndrom, die die frühe Kindheit überdauern, entwickeln später im Leben Anzeichen und Symptome des Kearns-Sayre-Syndroms.

Progressive externe Ophthalmoplegie

Mitochondriale DNA-Deletion oder -Mutation kann an einer Augenerkrankung beteiligt sein, die als progressive externe Ophthalmoplegie bezeichnet wird. Diese Störung schwächt die Muskeln, die die Augenbewegung kontrollieren, und führt dazu, dass die Augenlider hängen (Ptosis). Manche Menschen mit progressiver externer Ophthalmoplegie haben eine einzelne große Deletion der mitochondrialen DNA. Die häufigste Deletion ist 4.997 Nukleotide, wie beim Kearns-Sayre-Syndrom (oben beschrieben). Andere Menschen mit dieser Erkrankung haben eine Mutation im mitochondrialen Gen MT-TL1. Dieses Gen liefert Anweisungen zur Herstellung einer spezifischen tRNA namens tRNA Leu(UUR). Diese tRNA kommt nur in Mitochondrien vor und ist wichtig für den Zusammenbau der Proteine, die die oxidative Phosphorylierung durchführen.

Die A3243G-Mutation (oben beschrieben), die dieselbe genetische Veränderung ist, die mit MELAS in Verbindung gebracht wurde, ist eine relativ häufige Ursache für eine progressive externe Ophthalmoplegie. Es ist unklar, wie das gleiche MT-TL1 Genmutation kann zu verschiedenen Anzeichen und Symptomen führen. Mutationen im MT-TL1 Gen beeinträchtigen die Fähigkeit der Mitochondrien, Proteine ​​herzustellen, Sauerstoff zu verwenden und Energie zu produzieren, obwohl Forscher nicht festgestellt haben, wie diese Mutationen zu den spezifischen Anzeichen und Symptomen einer fortschreitenden externen Ophthalmoplegie führen.

Krebs

Mitochondriale DNA ist anfällig für somatische Mutationen, die eine Art nicht vererbter Mutation sind. Somatische Mutationen treten während des Lebens einer Person in der DNA bestimmter Zellen auf und werden normalerweise nicht an zukünftige Generationen weitergegeben. Es gibt nur begrenzte Beweise dafür, dass somatische Mutationen in der mitochondrialen DNA mit bestimmten Krebsarten, einschließlich Brust-, Dickdarm-, Magen-, Leber- und Nierentumoren, in Verbindung gebracht werden. Diese Mutationen können auch mit Krebs des blutbildenden Gewebes (Leukämie) und Krebs der Zellen des Immunsystems (Lymphom) in Verbindung gebracht werden.

Es ist möglich, dass somatische Mutationen in der mitochondrialen DNA die Produktion reaktiver Sauerstoffspezies erhöhen. Diese Moleküle schädigen die mitochondriale DNA und verursachen eine Ansammlung zusätzlicher somatischer Mutationen. Forscher untersuchen, wie diese Mutationen mit unkontrollierter Zellteilung und dem Wachstum von Krebstumoren zusammenhängen könnten.

Andere Störungen

Vererbte Veränderungen der mitochondrialen DNA können Probleme mit Wachstum, Entwicklung und Funktion der Körpersysteme verursachen. Diese Mutationen stören die Fähigkeit der Mitochondrien, effizient Energie für die Zelle zu erzeugen. Zustände, die durch Mutationen in der mitochondrialen DNA verursacht werden, betreffen oft mehrere Organsysteme. Die Auswirkungen dieser Erkrankungen sind in Organen und Geweben mit hohem Energiebedarf (wie Herz, Gehirn und Muskeln) am ausgeprägtesten. Obwohl die gesundheitlichen Folgen vererbter mitochondrialer DNA-Mutationen sehr unterschiedlich sind, sind einige häufig beobachtete Merkmale Muskelschwäche und -schwund, Bewegungsprobleme, Diabetes, Nierenversagen, Herzerkrankungen, Verlust der intellektuellen Funktionen (Demenz), Hörverlust und Anomalien der Augen und Vision.

Die meisten Körperzellen enthalten Tausende von Mitochondrien, jede mit einer oder mehreren Kopien der mitochondrialen DNA. Diese Zellen können eine Mischung aus Mitochondrien aufweisen, die mutierte und nicht mutierte DNA enthalten (Heteroplasmie). Es wird angenommen, dass die Schwere vieler mitochondrialer Erkrankungen mit dem Prozentsatz der Mitochondrien mit einer bestimmten genetischen Veränderung zusammenhängt.

Eine Anhäufung somatischer Mutationen in der mitochondrialen DNA wurde mit einem erhöhten Risiko für bestimmte altersbedingte Erkrankungen wie Herzerkrankungen, Alzheimer-Krankheit und Parkinson in Verbindung gebracht. Darüber hinaus deutet die Forschung darauf hin, dass die fortschreitende Anhäufung dieser Mutationen im Laufe des Lebens eine Rolle beim normalen Alterungsprozess spielen kann.


Verweise

Austin CR. Beobachtungen zur Penetration der Spermien in die Eizelle von Säugetieren. Aust J. Sci Res. B. 19514(4):581–596.

Bennett M. Shapiro. Die existenzielle Entscheidung eines Spermas, Zelle 49, Nr. 3 (Mai 1987): 293-94, insb. 293.

MC ändern. Befruchtungskapazität von Spermatozoen, die in die Eileiter eingelagert werden. Natur. 1951168(4277):697–698.

Choza J. (1991): Anthropología de la Sexualidad. Hrsg. Rialp. Madrid, 1.ª Edición.

J Clin Invest. (2010). Befruchtung: die Reise eines Spermiums zur und die Interaktion mit der Eizelle. Forschungsinstitut für mikrobielle Krankheiten, Universität Osaka, Osaka, Japan. School of Biological and Biomedical Sciences, Durham University, Vereinigtes Königreich. 120(4) 984–994.

Lennart Nilsson, Ein Porträt des Spermas. In: Die funktionelle Anatomie der Spermien, hrsg. Björn A. Afzelius (New York: Pergamon, 1975), 79-82.

Martin E. Das Ei und das Sperma: Wie die Wissenschaft eine Romanze konstruiert hat, die auf stereotypen Mann-Frau-Rollen basiert. „Zeichen“. vol. 16. Nr. 3 (Frühling, 1991), S. 485-501. Herausgegeben von: The University of Chicago Press.

Stein KK, Primakoff P, Myles D. Sperma-Ei-Fusion: Ereignisse an der Plasmamembran. J Cell Sci. 2004 117 (Pt 26): 6269–6274.

Paul M. Wassarman, Die Biologie und Chemie der Befruchtung, Science 235, Nr. 4788 (30. Januar 1987): 553-60, insbes. 554.

Paul M. Wassarman, Befruchtung bei Säugetieren, Scientific American 259, Nr. 6 (Dezember 1988): 78-84, insb. 78, 84.


Schau das Video: Tretman ćutanjem. I kako se ponašati ako ga primenjuju na vama (Januar 2023).