Information

Rosa E. coli-Zellpellet. Gründe dafür?

Rosa E. coli-Zellpellet. Gründe dafür?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe die Suspensionskultur von IPTG-induzierten E. coli BL21DE3-Zellen durch Schleudern bei 5000 U/min/15 min/4 Grad C geerntet. Das Pellet sah nach dem Schleudern blassrosa gefärbt aus. Was könnten die Gründe sein?


2.3B: Die gramnegative Zellwand

  • Beigetragen von Gary Kaiser
  • Professor (Mikrobiologie) am Community College of Baltimore Country (Cantonsville)
  1. Geben Sie an, welche Farbe Gram-negative Bakterien nach dem Gram-Färbungsverfahren anfärben.
  2. Beschreiben Sie die Zusammensetzung einer Gram-negativen Zellwand und zeigen Sie die möglichen nützlichen Funktionen für das Bakterium Peptidoglycan, die äußere Membran, Lipopolysaccharide, Porine und Oberflächenproteine ​​auf.
  3. Beschreiben Sie kurz, wie LPS und andere PAMPs der Gram-negativen Zellwand Entzündungen fördern können.
  4. Nennen Sie die Funktion bakterieller Adhäsine, Sekretionssysteme und Invasine.
  5. Definiere Periplasma.
  6. Definieren Sie Antigen und Epitop.

Hervorgehobenes Bakterium

  1. Lesen Sie die Beschreibung von Escherichia coli, und ordnen Sie das Bakterium der Beschreibung des Organismus und der von ihm verursachten Infektion zu.

Hervorgehobene Krankheit: Harnwegsinfektionen (HWI)

Betrachten wir nun die gramnegative Bakterienzellwand. Wie im vorherigen Abschnitt über Peptidoglycan erwähnt, sind Gram-negative Bakterien diejenigen, die sich während der Gram-Färbung entfärben, die Gegenfärbung Safranin aufnehmen und rosa erscheinen (Abbildung (PageIndex<2>)B.1).

Abbildung (PageIndex<2>)B.1: Gram-Färbung von Escherichia coli. Beachten Sie Gram-negative (rosa) Bazillen.

Häufige gramnegative Bakterien von medizinischer Bedeutung sind: Salmonellen Spezies, Shigella Spezies, Neisseria gonorrhoeae, Neisseria meningitidis, Haemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Proteus Arten, und Pseudomonas aeruginosa.

Klinische Krankheit

  • E coli verursacht rund 80 Prozent aller unkomplizierten Harnwegsinfektion (HWI) und mehr als 50 Prozent der nosokomialen HWI. Harnwegsinfektionen machen in den USA mehr als 7.000.000 Arztbesuche pro Jahr aus. Zwischen 35 und 40 Prozent aller nosokomialen Infektionen, etwa 900.000 pro Jahr in den USA, sind HWI und werden normalerweise mit einer Harnkatheterisierung in Verbindung gebracht.
  • E coli Ursachen Wundinfektionen, in der Regel als Folge einer fäkalen Kontamination äußerer Wunden oder als Folge von Wunden, die den Darmtrakt traumatisieren, wie Operationswunden, Schusswunden, Messerwunden usw.
  • E coli ist mit Abstand das häufigste gramnegative Bakterium, das Sepsis verursacht. Septikämie ist eine Folge von Bakterien, die ins Blut gelangen. Sie werden normalerweise von einer anderen Infektionsstelle in das Blut eingebracht, beispielsweise von einer infizierten Niere, Wunde oder Lunge. In den USA gibt es etwa 500.000 Fälle von Septikämie pro Jahr und die Sterblichkeitsrate liegt zwischen 20 und 50 Prozent. Ungefähr 45 Prozent der Fälle von Septikämie sind auf gramnegative Bakterien zurückzuführen. Klebsiella, Proteus, Enterobacter, Serratia, und E coli, sind alle gängigen gramnegativen Bakterien, die eine Septikämie verursachen.
  • E coli, zusammen mit Streptokokken der Gruppe B, sind die Hauptursache für neonatale Meningitis.
  • Während E coli ist eine der dominierenden Normalflora im Darmtrakt von Mensch und Tier, einige Belastungen können dazu führen Gastroenteritis, eine Infektion des Darmtraktes.
    • Enterotoxigene E coli (ETEC) produzieren Enterotoxine, die den Verlust von Natriumionen und Wasser aus dem Dünndarm verursachen, was zu wässrigem Durchfall führt. Mehr als die Hälfte aller Durchfallerkrankungen bei Reisenden sind auf ETEC zurückzuführen, fast 80.000 Fälle pro Jahr in den USA.
    • Enteropathogen E coli (EPEC) verursachen in Gebieten der Entwicklungsländer eine endemische Diarrhoe, insbesondere bei Säuglingen unter 6 Monaten. Das Bakterium zerstört die normalen Mikrovilli auf den Epithelzellen des Dünndarms, was zu Maladsorbtion und Durchfall führt.
    • Enteroaggregativ E coli (EAEC) ist eine Ursache für anhaltenden Durchfall in Entwicklungsländern. Es verursacht wahrscheinlich Durchfall, indem es an Schleimhautepithelzellen des Dünndarms haftet und deren Funktion beeinträchtigt.
    • Enteroinvasiv E coli (EIEC) dringen in Epithelzellen des Dickdarms ein und töten sie ab und verursachen ein dysenterieartiges Syndrom ähnlich wie Shigella in unterentwickelten Ländern üblich.
    • Enterohämorrhagisch E coli (EHEC), wie zum Beispiel E coli 0157:H7, produzieren ein Shiga-ähnliches Toxin, das Epithelzellen des Dickdarms abtötet und eine hämorrhagische Kolitis, einen blutigen Durchfall, verursacht. In seltenen Fällen gelangt das Shigatoxin ins Blut und wird zu den Nieren transportiert, wo es, meist bei Kindern, Gefäßzellen schädigt und ein hämolytisch-urämisches Syndrom verursacht. E coli 0157:H7 soll in den USA mehr als 20.000 Infektionen und bis zu 250 Todesfälle pro Jahr verursachen.
    • Diffuses Aggregat E coli(DAEC) verursacht wässrigen Durchfall bei Säuglingen im Alter von 1-5 Jahren. Sie stimulieren die Verlängerung der Mikrovilli auf den Epithelzellen, die den Dünndarm auskleiden.
    • Für weitere Informationen: Die Gram-Färbung aus Labor 6.
    • Flash-Animation zur Veranschaulichung der Interaktion der Gram-Färbereagenzien auf molekularer Ebene & Kopie Daniel Cavanaugh, Mark Keen, Autoren, Licensed for use, ASM MicrobeLibrary.
    • Hervorgehobene Infektion: Harnwegsinfektionen (HWI)

    Antworten

    Ja, bei der Resuspension wird das Zellpellet aufgebrochen. Es bedeutet, die Zellen wieder in Lösung zu bringen. Normalerweise beinhaltet dies das Vortexen der Probe, was nicht gerade schonend ist, aber in dieser Phase des Verfahrens normalerweise kein Problem darstellt. Erst nachdem Lyse-Vorräte hinzugefügt wurden, muss mehr Sorgfalt aufgewendet werden, damit genomische DNA nicht geschreddert wird.

    BhacSsylan ( 9522 />) “Großartige Antwort” ( 3 />) ScottyMcGeester ( 1897 />) “Großartige Antwort” ( 0 />)

    Angenommen, Sie haben ein DNA-Pellet. Diesmal kein Zellpellet. Offensichtlich ist es sehr klein, aber Sie gehen davon aus, dass es sich in der Tube befindet, nachdem Sie es mit Ethanol gewaschen haben. Mein Verfahren sagt “überschüssiges Ethanol entfernen”. Ich bin mir nicht sicher, wie dies formuliert ist, weil es nicht genau klar ist, ob dies bedeutet „Entfernen Sie das gesamte Ethanol, das Sie zum Waschen der DNA verwendet haben“, oder „Entfernen Sie nur einen Teil davon“.

    Ich habe bereits Ergebnisse erhalten, aber der Punkt ist –, was ist der beste Weg, um Ethanol nach dem Waschen eines DNA-Pellets und anschließendem Resuspendieren zu entfernen? Wie kann ich sicher sein, dass ich nicht versehentlich etwas DNA herauspipettiert habe, als ich das Ethanol entfernt habe?

    ScottyMcGeester ( 1897 />) “Große Antwort” ( 0 />)

    Hmm, ich habe noch nie DNA mit Ethanol gewaschen, das ist seltsam. Nun, Spalten habe ich, aber kein Pellet. Im Allgemeinen müssen Sie jedoch alles loswerden. Ethanol stört die meisten Reaktionen, die Sie mit DNA durchführen möchten. Um es loszuwerden, ist Luftblasen wahrscheinlich die beste Methode, da es leicht verdunstet, aber Sie müssen vorsichtig sein, um sicherzustellen, dass es wirklich vollständig verschwunden ist.

    BhacSsylan ( 9522 />) “Große Antwort” ( 0 />)

    Inhalt

    Typ und Morphologie Bearbeiten

    E coli ist ein gramnegatives, fakultativ anaerobes Bakterium (das ATP durch aerobe Atmung bildet, wenn Sauerstoff vorhanden ist, aber in der Lage ist, auf Fermentation oder anaerobe Atmung umzuschalten, wenn Sauerstoff fehlt) und nicht sporenbildendes Bakterium. [17] Zellen sind typischerweise stäbchenförmig und haben eine Länge von etwa 2,0 μm, einen Durchmesser von 0,25–1,0 μm und ein Zellvolumen von 0,6–0,7 μm 3 . [18] [19] [20]

    E coli färbt Gram-negativ, weil seine Zellwand aus einer dünnen Peptidoglycanschicht und einer äußeren Membran besteht. Während des Färbeprozesses, E coli nimmt die Farbe der Gegenfärbung Safranin auf und färbt rosa. Die äußere Membran, die die Zellwand umgibt, stellt eine Barriere für bestimmte Antibiotika dar, so dass E coli wird durch Penicillin nicht geschädigt. [fünfzehn]

    Stämme, die Flagellen besitzen, sind beweglich. Die Geißeln haben eine peritriche Anordnung. [21] Es heftet sich auch über ein Adhäsionsmolekül, das als Intimin bekannt ist, an die Mikrovilli des Darms und verwischt sie dort. [22]

    Stoffwechsel Bearbeiten

    E coli kann auf einer Vielzahl von Substraten leben und verwendet gemischte Säurefermentation unter anaeroben Bedingungen, wobei Laktat, Succinat, Ethanol, Acetat und Kohlendioxid produziert werden. Da viele Wege bei der Mischsäure-Fermentation Wasserstoffgas produzieren, erfordern diese Wege einen niedrigen Wasserstoffgehalt, wie es der Fall ist, wenn E coli lebt mit wasserstoffverbrauchenden Organismen wie Methanogenen oder sulfatreduzierenden Bakterien zusammen. [23]

    Zusätzlich, E coli's Stoffwechsel kann umverdrahtet werden, um ausschließlich CO . zu verwenden2 als Kohlenstoffquelle für die Biomasseproduktion. Mit anderen Worten, der Metabolismus dieses obligaten Heterotrophen kann verändert werden, um autotrophe Fähigkeiten zu zeigen, indem man Kohlenstofffixierungsgene sowie Formiatdehydrogenase heterolog exprimiert und Laborexperimente zur Evolution durchführt. Dies kann durch die Verwendung von Formiat erfolgen, um Elektronenträger zu reduzieren und das ATP bereitzustellen, das in anabolen Stoffwechselwegen innerhalb dieser synthetischen Autotrophen erforderlich ist. [24]

    E coli haben drei native glykolytische Wege: EMPP, EDP und OPPP. Das EMPP verwendet zehn enzymatische Schritte, um zwei Pyruvate, zwei ATP und zwei NADH pro Glucosemolekül zu ergeben, während OPPP als Oxidationsweg für die NADPH-Synthese dient. Obwohl der EDP der thermodynamisch günstigere der drei Wege ist, E coli verwenden Sie das EDP nicht für den Glukosestoffwechsel, sondern verlassen sich hauptsächlich auf das EMPP und das OPPP. Außer während des Wachstums mit Gluconat bleibt die EDP überwiegend inaktiv. [25]

    Katabolitenrepression Bearbeiten

    Wenn sie in Gegenwart einer Zuckermischung wachsen, verbrauchen Bakterien die Zucker oft nacheinander durch einen Prozess, der als Katabolitrepression bekannt ist. Durch die Unterdrückung der Expression der Gene, die an der Metabolisierung der weniger bevorzugten Zucker beteiligt sind, verbrauchen Zellen normalerweise zuerst den Zucker, der die höchste Wachstumsrate ergibt, gefolgt von dem Zucker, der die nächsthöhere Wachstumsrate ergibt, und so weiter. Dabei stellen die Zellen sicher, dass ihre begrenzten Stoffwechselressourcen genutzt werden, um die Wachstumsrate zu maximieren. Das bekannte Beispiel dafür mit E coli beinhaltet das Wachstum des Bakteriums auf Glukose und Laktose, wobei E coli wird Glukose vor Laktose verbrauchen. Katabolitenrepression wurde auch bei beobachtet E coli in Gegenwart anderer Nicht-Glucose-Zucker, wie Arabinose und Xylose, Sorbit, Rhamnose und Ribose. In E coli, wird die Glukosekatabolitrepression durch das Phosphotransferasesystem reguliert, eine Multi-Protein-Phosphorylierungskaskade, die die Glukoseaufnahme und den Glukosestoffwechsel koppelt. [26]

    Kulturwachstum Bearbeiten

    Optimales Wachstum von E coli tritt bei 37 ° C (98,6 ° F) auf, aber einige Laborstämme können sich bei Temperaturen bis zu 49 ° C (120 ° F) vermehren. [27] E coli wächst in einer Vielzahl von definierten Labormedien, wie Lysogenie-Brühe oder jedem Medium, das Glucose, monobasisches Ammoniumphosphat, Natriumchlorid, Magnesiumsulfat, dibasisches Kaliumphosphat und Wasser enthält. Das Wachstum kann durch aerobe oder anaerobe Atmung unter Verwendung einer Vielzahl von Redoxpaaren angetrieben werden, einschließlich der Oxidation von Brenztraubensäure, Ameisensäure, Wasserstoff und Aminosäuren und der Reduktion von Substraten wie Sauerstoff, Nitrat, Fumarat, Dimethylsulfoxid, und Trimethylamin-N-oxid. [28] E coli wird als fakultativ anaerob eingestuft. Es verwendet Sauerstoff, wenn es vorhanden und verfügbar ist. Es kann jedoch in Abwesenheit von Sauerstoff durch Fermentation oder anaerobe Atmung weiter wachsen. Die Fähigkeit, in Abwesenheit von Sauerstoff weiter zu wachsen, ist für Bakterien von Vorteil, da ihr Überleben in Umgebungen, in denen Wasser vorherrscht, erhöht wird. [fünfzehn]

    Zellzyklus Bearbeiten

    Der bakterielle Zellzyklus ist in drei Phasen unterteilt. Die B-Periode tritt zwischen dem Abschluss der Zellteilung und dem Beginn der DNA-Replikation auf. Die C-Periode umfasst die Zeit, die benötigt wird, um die chromosomale DNA zu replizieren. Die D-Periode bezeichnet das Stadium zwischen dem Abschluss der DNA-Replikation und dem Ende der Zellteilung. [29] Die Verdopplungsrate von E coli ist höher, wenn mehr Nährstoffe zur Verfügung stehen. Die Länge der C- und D-Perioden ändert sich jedoch nicht, selbst wenn die Verdopplungszeit kleiner wird als die Summe der C- und D-Perioden. Bei den schnellsten Wachstumsraten beginnt die Replikation, bevor die vorherige Replikationsrunde abgeschlossen ist, was zu mehreren Replikationsgabeln entlang der DNA und überlappenden Zellzyklen führt. [30]

    Die Zahl der Replikationsgabeln im schnell wachsenden E coli folgt typischerweise 2n (n = 1, 2 oder 3). Dies geschieht nur, wenn die Replikation gleichzeitig von allen Replikationsursprüngen initiiert wird und wird als synchrone Replikation bezeichnet. Allerdings replizieren nicht alle Zellen in einer Kultur synchron. In diesem Fall haben Zellen kein Vielfaches von zwei Replikationsgabeln. Die Replikationsinitiierung wird dann als asynchron bezeichnet. [31] Asynchronität kann jedoch durch Mutationen beispielsweise zu DnaA [31] oder dem DnaA-Initiator-assoziierenden Protein DiaA verursacht werden. [32]

    Genetische Anpassung Bearbeiten

    E coli und verwandte Bakterien besitzen die Fähigkeit, DNA über bakterielle Konjugation oder Transduktion zu übertragen, wodurch sich genetisches Material horizontal durch eine bestehende Population ausbreiten kann. Der Transduktionsprozess, bei dem das Bakteriophage genannte bakterielle Virus [33] verwendet wird, ist der Ort, an dem sich das Gen ausbreitet, das für das Shiga-Toxin kodiert Shigella Bakterien zu E coli half produzieren E coli O157:H7, der Shiga-Toxin-produzierende Stamm von E coli.

    E coli umfasst eine enorme Population von Bakterien, die ein sehr hohes Maß an genetischer und phänotypischer Vielfalt aufweisen. Genomsequenzierung vieler Isolate von E coli und verwandten Bakterien zeigt, dass eine taxonomische Neuklassifizierung wünschenswert wäre. Dies wurde jedoch vor allem aufgrund seiner medizinischen Bedeutung nicht durchgeführt [34] und E coli bleibt eine der vielfältigsten Bakterienarten: nur 20 % der Gene in einem typischen E coli Genom wird von allen Stämmen geteilt. [35]

    In der Tat, vom konstruktiveren Standpunkt aus gesehen, sind die Mitglieder der Gattung Shigella (S. dysenteriae, S. flexneri, S. boydii, und S. sonne) sollte klassifiziert werden als E coli Stämme, ein Phänomen, das als getarnte Taxa bezeichnet wird. [36] Auch andere Stämme von E coli (z. B. der K-12-Stamm, der üblicherweise bei rekombinanten DNA-Arbeiten verwendet wird) sind ausreichend unterschiedlich, um eine Neuklassifizierung zu verdienen.

    Ein Stamm ist eine Untergruppe innerhalb der Art, die einzigartige Merkmale aufweist, die ihn von anderen Stämmen unterscheiden. Diese Unterschiede sind oft nur auf molekularer Ebene nachweisbar, können jedoch zu Veränderungen der Physiologie oder des Lebenszyklus des Bakteriums führen. Zum Beispiel kann ein Stamm eine pathogene Kapazität erlangen, die Fähigkeit, eine einzigartige Kohlenstoffquelle zu nutzen, die Fähigkeit, eine bestimmte ökologische Nische einzunehmen, oder die Fähigkeit, antimikrobiellen Mitteln zu widerstehen. Verschiedene Stämme von E coli sind oft wirtsspezifisch, wodurch es möglich ist, die Quelle der fäkalen Kontamination in Umweltproben zu bestimmen. [12] [13] Zum Beispiel wissen, welche E coli Stämme in einer Wasserprobe vorhanden sind, ermöglicht es Forschern, Annahmen darüber zu treffen, ob die Kontamination von einem Menschen, einem anderen Säugetier oder einem Vogel stammt.

    Serotypen Bearbeiten

    Ein gemeinsames Unterteilungssystem von E coli, aber nicht auf evolutionärer Verwandtschaft basiert, ist nach Serotyp, der auf Hauptoberflächenantigenen basiert (O-Antigen: Teil der Lipopolysaccharidschicht H: Flagellin K-Antigen: Kapsel), z.B. O157:H7). [37] Es ist jedoch üblich, nur die Serogruppe, also das O-Antigen, zu nennen. Derzeit sind etwa 190 Serogruppen bekannt. [38] Der gängige Laborstamm weist eine Mutation auf, die die Bildung eines O-Antigens verhindert und somit nicht typisierbar ist.

    Genomplastizität und Evolution Bearbeiten

    Wie alle Lebensformen, neue Stämme von E coli entwickeln sich durch die natürlichen biologischen Prozesse der Mutation, Genduplikation und insbesondere des horizontalen Gentransfers, 18% des Genoms des Laborstamms MG1655 wurden seit der Divergenz von MG1655 horizontal erworben Salmonellen. [39] E coli K-12 und E coli B-Stämme sind die am häufigsten verwendeten Sorten für Laborzwecke. Einige Stämme entwickeln Eigenschaften, die für ein Wirtstier schädlich sein können. Diese virulenten Stämme verursachen typischerweise einen Anfall von Durchfall, der bei gesunden Erwachsenen oft selbstlimitierend ist, aber für Kinder in Entwicklungsländern häufig tödlich ist. [40] Virulentere Stämme wie O157:H7 führen bei älteren, sehr jungen oder immungeschwächten Personen zu schweren Erkrankungen oder zum Tod. [40] [41]

    Die Gattungen Escherichia und Salmonellen divergierten vor etwa 102 Millionen Jahren (Glaubwürdigkeitsintervall: 57–176 Millionen Jahre), was mit der Divergenz ihrer Wirte zusammenfällt: erstere in Säugetieren und letztere in Vögeln und Reptilien. [42] Darauf folgte eine Aufspaltung von an Escherichia Vorfahren in fünf Arten (E. albertii, E coli, E. fergusonii, E. hermannii, und E. vulneris). Das Letzte E coli Vorfahren gespalten zwischen 20 und 30 Millionen Jahren. [43]

    Die langfristigen Evolutionsexperimente mit E coli, die 1988 von Richard Lenski begonnen wurde, haben die direkte Beobachtung der Genomentwicklung über mehr als 65.000 Generationen im Labor ermöglicht. [44] Zum Beispiel E coli haben typischerweise nicht die Fähigkeit, mit Citrat als Kohlenstoffquelle aerob zu wachsen, was als diagnostisches Kriterium zur Differenzierung verwendet wird E coli von anderen, eng verwandten Bakterien, wie z Salmonellen. In diesem Experiment wurde eine Population von E coli entwickelten unerwartet die Fähigkeit, Citrat aerob zu metabolisieren, eine bedeutende evolutionäre Verschiebung mit einigen Kennzeichen der mikrobiellen Speziation.

    In der mikrobiellen Welt kann eine Prädationsbeziehung ähnlich der in der Tierwelt festgestellt werden. Es wurde festgestellt, dass E. coli die Beute mehrerer generalistischer Raubtiere ist, wie z Myxococcus xanthus. In dieser Räuber-Beute-Beziehung wird eine parallele Evolution beider Arten durch genomische und phänotypische Modifikationen beobachtet, im Fall von E.coli werden die Modifikationen in zwei Aspekten modifiziert, die an ihrer Virulenz beteiligt sind, wie der Schleimproduktion (übermäßige Produktion von Exoplasmatsäure-Alginat) und der Unterdrückung des OmpT-Gens, was in zukünftigen Generationen zu einer besseren Anpassung einer der Spezies führt, der durch die Evolution entgegengewirkt wird des anderen, nach einem koevolutionären Modell, das durch die Red-Queen-Hypothese demonstriert wird. [45]

    Neotyp-Stamm Bearbeiten

    E coli ist die Typusart der Gattung (Escherichia) und wiederum Escherichia ist die Typusgattung der Familie Enterobacteriaceae, wobei der Familienname nicht von der Gattung abstammt Enterobakterien + "i" (sic.) + "aceae", aber von "Enterobacterium" + "aceae" (Enterobacterium ist keine Gattung, sondern ein alternativer Trivialname zu Darmbakterien). [46] [47]

    Der von Escherich beschriebene ursprüngliche Stamm gilt als verloren, daher wurde stellvertretend ein neuer Typstamm (Neotyp) gewählt: Der Neotypstamm ist U5/41 T , [48] auch bekannt unter dem Hinterlegungsnamen DSM 30083, [49] ATCC 11775, [50] und NCTC 9001, [51], das für Hühner pathogen ist und einen O1:K1:H7-Serotyp aufweist. [52] In den meisten Studien wurden jedoch entweder O157:H7, K-12 MG1655 oder K-12 W3110 als Vertreter verwendet E coli. Das Genom des Typusstammes wurde erst kürzlich sequenziert. [48]

    Phylogenie von E coli Stämme Bearbeiten

    Viele Stämme dieser Art wurden isoliert und charakterisiert. Neben Serotyp (siehe oben), können sie nach ihrer Phylogenie, d.h. der abgeleiteten Evolutionsgeschichte, klassifiziert werden, wie unten gezeigt, wo die Art in sechs Gruppen unterteilt ist. [53] [54] Besonders die Verwendung ganzer Genomsequenzen führt zu stark gestützten Phylogenien. Basierend auf diesen Daten wurden fünf Unterarten von E coli unterschieden wurden. [48]

    Der Zusammenhang zwischen phylogenetischer Distanz ("Verwandtschaft") und Pathologie ist gering, [48] z.B. die O157:H7-Serotyp-Stämme, die eine Klade ("eine exklusive Gruppe") bilden – Gruppe E unten – sind alle enterohämorrhagische Stämme (EHEC), aber nicht alle EHEC-Stämme sind eng verwandt. Tatsächlich sind vier verschiedene Arten von Shigella sind verschachtelt unter E coli Stämme (siehe oben), während E. albertii und E. fergusonii sind außerhalb dieser Gruppe. In der Tat, alle Shigella Arten wurden innerhalb einer einzigen Unterart von E coli in einer phylogenomischen Studie, die den Typstamm einschloss, [48] und aus diesem Grund ist eine entsprechende Umklassifizierung schwierig. Alle gängigen Forschungsstämme von E coli gehören zur Gruppe A und stammen hauptsächlich von Cliftons K-12-Stamm (λ + F + O16) und in geringerem Maße von d'Herelles Bacillus coli Stamm (B-Stamm)(O7).

    E coli S88 (O45:K1. Extrazellulär pathogen)

    E coli UMN026 (O17:K52:H18. Extrazellulär pathogen)

    E coli (O19:H34. Extrazellulär pathogen)

    E coli (O7:K1. Extrazellulär pathogen)

    E coli GOS1 (O104:H4 EAHEC) Deutscher Ausbruch 2011

    E coli ATCC8739 (O146. Crooks E. coli, die in den 1950er Jahren in der Phagenarbeit verwendet wurden)

    E coli K-12 W3110 (O16. λ − F − molekularbiologischer „Wildtyp“-Stamm)

    E coli K-12 DH10b (O16. Molekularbiologiestamm mit hoher Elektrokompetenz)

    E coli K-12 DH1 (O16. Molekularbiologiestamm mit hoher chemischer Kompetenz)

    E coli K-12 MG1655 (O16. λ − F − Molekularbiologie-Stamm "Wildtyp")

    E coli BW2952 (O16. kompetenter molekularbiologischer Stamm)

    E coli B REL606 (O7. hochkompetenter molekularbiologischer Stamm)

    E coli BL21-DE3 (O7. molekularbiologischer Expressionsstamm mit T7-Polymerase für das pET-System)

    Die erste vollständige DNA-Sequenz eines E coli Genom (Laborstamm K-12-Derivat MG1655) wurde 1997 veröffentlicht. Es ist ein zirkuläres DNA-Molekül mit einer Länge von 4,6 Millionen Basenpaaren, das 4288 annotierte proteinkodierende Gene (organisiert in 2584 Operons), sieben ribosomale RNA (rRNA)-Operons, und 86 Transfer-RNA (tRNA)-Gene. Obwohl sie seit etwa 40 Jahren Gegenstand intensiver genetischer Analysen sind, waren viele dieser Gene bisher unbekannt. Die Kodierungsdichte erwies sich als sehr hoch, mit einem mittleren Abstand zwischen den Genen von nur 118 Basenpaaren. Es wurde beobachtet, dass das Genom eine signifikante Anzahl von transponierbaren genetischen Elementen, Wiederholungselementen, kryptischen Prophagen und Bakteriophagenresten enthält. [55]

    Mehr als dreihundert vollständige genomische Sequenzen von Escherichia und Shigella Arten bekannt sind. Die Genomsequenz des Typstamms von E coli wurde dieser Sammlung vor 2014 hinzugefügt. [48] Der Vergleich dieser Sequenzen zeigt eine bemerkenswerte Vielfalt, nur etwa 20 % jedes Genoms repräsentieren Sequenzen, die in jedem der Isolate vorhanden sind, während etwa 80 % jedes Genoms zwischen den Isolaten variieren können. [35] Jedes einzelne Genom enthält zwischen 4.000 und 5.500 Gene, aber die Gesamtzahl der verschiedenen Gene unter allen sequenzierten E coli Stämme (das Pangenom) überschreitet 16.000. Diese sehr große Vielfalt an Komponentengenen wurde so interpretiert, dass zwei Drittel der E coli pangenome stammt von anderen Arten und gelangte durch den Prozess des horizontalen Gentransfers. [56]

    Gene in E coli werden normalerweise mit 4-Buchstaben-Akronymen benannt, die sich von ihrer Funktion ableiten (sofern bekannt) und kursiv geschrieben. Zum Beispiel, recA ist nach seiner Rolle bei der homologen Rekombination und dem Buchstaben A benannt. Funktionell verwandte Gene werden benannt recB, recC, recD usw. Die Proteine ​​werden durch Akronyme in Großbuchstaben benannt, z.B. RecA, RecB usw. Wenn das Genom von E coli sequenziert wurde, wurden alle Gene in ihrer Reihenfolge auf dem Genom (mehr oder weniger) nummeriert und mit b-Nummern abgekürzt, wie b2819 (= recD). Die "b"-Namen wurden nach Fred . erstellt Blattner, der die Genomsequenzierung leitete. [55] Ein anderes Nummerierungssystem wurde mit der Folge eines anderen eingeführt E coli Stamm, W3110, der in Japan sequenziert wurde und daher Nummern verwendet, die mit JW beginnen. (Japanesisch W3110), z.B. JW2787 (= recD). [57] Daher recD = b2819 = JW2787. Beachten Sie jedoch, dass die meisten Datenbanken über ein eigenes Nummerierungssystem verfügen, z. die EcoGene-Datenbank [58] verwendet EG10826 für recD. Schließlich werden ECK-Nummern speziell für Allele im Stamm MG1655 von verwendet E coli K-12. [58] Vollständige Listen der Gene und ihrer Synonyme können aus Datenbanken wie EcoGene oder Uniprot abgerufen werden.

    Proteom Bearbeiten

    Mehrere Studien haben das Proteom von E coli. Bis 2006 wurden 1.627 (38 %) der 4.237 offenen Leserahmen (ORFs) experimentell identifiziert. [59] Die 4.639.221 Basenpaare lange Sequenz von Escherichia coli K-12 wird vorgestellt. Von 4288 annotierten proteinkodierenden Genen haben 38 Prozent keine zugeschriebene Funktion. Der Vergleich mit fünf anderen sequenzierten Mikroben zeigt sowohl ubiquitäre als auch eng verteilte Genfamilien, viele Familien ähnlicher Gene innerhalb E coli sind ebenfalls ersichtlich. Die größte Familie paraloger Proteine ​​enthält 80 ABC-Transporter. Das Genom als Ganzes ist in Bezug auf die lokale Replikationsrichtung auffallend organisiert Guanine, Oligonukleotide, die möglicherweise mit Replikation und Rekombination in Verbindung stehen, und die meisten Gene sind so ausgerichtet. Das Genom enthält auch Elemente der Insertionssequenz (IS), Phagenreste und viele andere Flecken ungewöhnlicher Zusammensetzung, die auf Genomplastizität durch horizontalen Transfer hindeuten. [55]

    Interaktom Bearbeiten

    Das Interaktom von E coli wurde durch Affinitätsreinigung und Massenspektrometrie (AP/MS) und durch Analyse der binären Wechselwirkungen zwischen seinen Proteinen untersucht.

    Proteinkomplexe. Eine Studie aus dem Jahr 2006 reinigte 4.339 Proteine ​​aus Kulturen des Stamms K-12 und fand Interaktionspartner für 2.667 Proteine, von denen viele zu dieser Zeit unbekannte Funktionen hatten. [60] Eine Studie aus dem Jahr 2009 fand 5.993 Interaktionen zwischen Proteinen derselben E coli Stamm, obwohl diese Daten wenig Überlappung mit denen der Veröffentlichung von 2006 zeigten. [61]

    Binäre Wechselwirkungen. Rajagopala et al. (2014) haben systematische Hefe-Zwei-Hybrid-Screens mit den meisten E coli Proteine ​​und fanden insgesamt 2.234 Protein-Protein-Wechselwirkungen. [62] Diese Studie integrierte auch genetische Wechselwirkungen und Proteinstrukturen und kartierte 458 Wechselwirkungen innerhalb von 227 Proteinkomplexen.

    E coli gehört zu einer Gruppe von Bakterien, die informell als Coliforme bezeichnet werden und im Magen-Darm-Trakt von Warmblütern vorkommen. [63] E coli besiedelt normalerweise den Magen-Darm-Trakt eines Säuglings innerhalb von 40 Stunden nach der Geburt und gelangt mit Nahrung oder Wasser oder von den Personen, die das Kind behandeln. Im Darm, E coli haftet am Schleim des Dickdarms. Es ist der primäre fakultative Anaerobier des menschlichen Magen-Darm-Trakts. [64] (Fakultative Anaerobier sind Organismen, die in Gegenwart oder Abwesenheit von Sauerstoff wachsen können.) Solange diese Bakterien keine genetischen Elemente erwerben, die für Virulenzfaktoren kodieren, bleiben sie gutartige Kommensalen. [65]

    Therapeutischer Gebrauch Bearbeiten

    Aufgrund der geringen Kosten und Geschwindigkeit, mit der es in Laborumgebungen angebaut und modifiziert werden kann, E coli ist eine beliebte Expressionsplattform zur Herstellung rekombinanter Proteine, die in Therapeutika verwendet werden. Ein Vorteil bei der Verwendung E coli über eine andere Ausdrucksplattform ist das E coli exportiert natürlich nicht viele Proteine ​​in das Periplasma, was die Gewinnung eines interessierenden Proteins ohne Kreuzkontamination erleichtert. [66] Die E coli K-12-Stämme und ihre Derivate (DH1, DH5α, MG1655, RV308 und W3110) sind die von der Biotechnologie-Industrie am häufigsten verwendeten Stämme. [67] Nicht pathogen E coli Stamm Nissle 1917 (EcN), (Mutaflor) und E coli O83:K24:H31 (Colinfant) [68] [69] ) werden als probiotische Wirkstoffe in der Medizin vor allem zur Behandlung verschiedener Magen-Darm-Erkrankungen, [70] einschließlich entzündlicher Darmerkrankungen eingesetzt. [71] Es wird vermutet, dass der EcN-Stamm das Wachstum opportunistischer Krankheitserreger, einschließlich Salmonellen und andere coliforme Enteropathogene, durch die Produktion von Microcin-Proteinen die Produktion von Siderophoren. [72]

    Die meisten E coli Stämme verursachen keine Krankheiten, sie leben von Natur aus im Darm, [73] aber virulente Stämme können Gastroenteritis, Harnwegsinfektionen, neonatale Meningitis, hämorrhagische Kolitis und Morbus Crohn verursachen. Häufige Anzeichen und Symptome sind schwere Bauchkrämpfe, Durchfall, hämorrhagische Kolitis, Erbrechen und manchmal Fieber. In selteneren Fällen sind virulente Stämme auch für Darmnekrose (Gewebetod) und Perforation verantwortlich, ohne dass es zu einem hämolytisch-urämischen Syndrom, Peritonitis, Mastitis, Sepsis und Gram-negativer Pneumonie kommt. Sehr junge Kinder sind anfälliger für schwere Krankheiten wie das hämolytisch-urämische Syndrom, jedoch sind gesunde Personen jeden Alters den schwerwiegenden Folgen ausgesetzt, die als Folge einer Infektion mit E coli. [64] [74] [75] [76]

    Einige Stämme von E coli, zum Beispiel O157:H7, kann Shiga-Toxin produzieren (als Bioterrorismus eingestuft). Das Shiga-Toxin verursacht Entzündungsreaktionen in Zielzellen des Darms und hinterlässt Läsionen, die zu blutigem Durchfall führen, der ein Symptom für eine Shiga-Toxin-produzierende ist E coli (STEC)-Infektion. Dieses Toxin führt außerdem zu einer vorzeitigen Zerstörung der roten Blutkörperchen, die dann das Filtersystem des Körpers, die Nieren, verstopfen und in einigen seltenen Fällen (normalerweise bei Kindern und älteren Menschen) ein hämolytisch-urämisches Syndrom (HUS) verursachen, das zu Nierenversagen führen kann und sogar der Tod. Anzeichen eines hämolytisch-urämischen Syndroms sind eine verminderte Häufigkeit des Wasserlassens, Lethargie und Blässe der Wangen und der unteren Augenlider. Bei 25% der HUS-Patienten treten Komplikationen des Nervensystems auf, die wiederum Schlaganfälle verursachen. Darüber hinaus verursacht diese Belastung eine Ansammlung von Flüssigkeit (da die Nieren nicht arbeiten), was zu Ödemen um Lunge, Beine und Arme führt. Diese Zunahme der Flüssigkeitsansammlung insbesondere um die Lunge herum behindert die Herzfunktion und führt zu einem Anstieg des Blutdrucks. [77] [22] [78] [79] [80] [75] [76]

    Uropathogen E coli (UPEC) ist eine der Hauptursachen für Harnwegsinfektionen. [81] Es ist Teil der normalen Mikrobiota im Darm und kann auf vielfältige Weise eingebracht werden. Insbesondere bei Frauen kann die Wischrichtung nach dem Stuhlgang (Wischen von hinten nach vorne) zu einer fäkalen Kontamination der Urogenitalöffnungen führen. Analverkehr kann dieses Bakterium auch in die männliche Harnröhre einführen, und beim Wechsel vom Anal- zum Vaginalverkehr kann der Mann auch UPEC in das weibliche Urogenitalsystem einführen.

    Enterotoxinbildend E coli (ETEC) ist mit jährlich bis zu 840 Millionen Fällen weltweit in Entwicklungsländern die häufigste Ursache für Reisedurchfall. Die Bakterien, die typischerweise durch kontaminiertes Essen oder Trinkwasser übertragen werden, haften an der Darmschleimhaut, wo sie eine von zwei Arten von Enterotoxinen absondern, was zu wässrigem Durchfall führt. Die Rate und der Schweregrad der Infektionen sind bei Kindern unter fünf Jahren höher, darunter bis zu 380.000 Todesfälle pro Jahr. [82]

    Im Mai 2011 wurde ein E coli Stamm, O104:H4, war Gegenstand eines bakteriellen Ausbruchs, der in Deutschland begann. Bestimmte Stämme von E coli sind eine der Hauptursachen für lebensmittelbedingte Erkrankungen. Der Ausbruch begann, als sich mehrere Menschen in Deutschland mit enterohämorrhagischen . infizierten E coli (EHEC) Bakterien, die zum hämolytisch-urämischen Syndrom (HUS) führen, einem medizinischen Notfall, der dringend behandelt werden muss. Der Ausbruch betraf nicht nur Deutschland, sondern auch 15 weitere Länder, darunter Regionen in Nordamerika. [83] Am 30. Juni 2011 hat die deutsche Bundesinstitut für Risikobewertung (BfR) (Bundesinstitut für Risikobewertung, eine Bundesanstalt im Bundesministerium für Ernährung, Landwirtschaft und Verbraucherschutz) gab bekannt, dass Bockshornkleesamen aus Ägypten wahrscheinlich die Ursache des EHEC-Ausbruchs sind. [84]

    Einige Studien haben das Fehlen von E.coli in der Darmflora von Patienten mit der Stoffwechselstörung Phenylketonurie. Es wird vermutet, dass das Fehlen dieser normalen Bakterien die Produktion der wichtigen Vitamine B . beeinträchtigt2 (Riboflavin) und K2 (Menachinon) - Vitamine, die an vielen physiologischen Funktionen beim Menschen beteiligt sind, wie dem Zell- und Knochenstoffwechsel - und tragen so zur Erkrankung bei. [85]

    Inkubationszeit Bearbeiten

    Die Zeit zwischen der Aufnahme der STEC-Bakterien und dem Krankheitsgefühl wird als „Inkubationszeit“ bezeichnet. Die Inkubationszeit beträgt in der Regel 3–4 Tage nach der Exposition, kann aber auch nur 1 Tag oder 10 Tage betragen. Die Symptome beginnen oft langsam mit leichten Bauchschmerzen oder nicht-blutigem Durchfall, der sich über mehrere Tage verschlimmert. HUS, wenn es auftritt, entwickelt sich durchschnittlich 7 Tage nach den ersten Symptomen, wenn sich der Durchfall bessert. [86]

    Diagnose Bearbeiten

    Die Diagnose von infektiösem Durchfall und der Nachweis einer antimikrobiellen Resistenz erfolgt anhand einer Stuhlkultur mit anschließender Antibiotika-Empfindlichkeitsprüfung. Es dauert mindestens 2 Tage und maximal mehrere Wochen, um gastrointestinale Krankheitserreger zu kultivieren. Die Sensitivitäts- (richtig positiv) und Spezifitätsraten (richtig negativ) für die Stuhlkultur variieren je nach Erreger, obwohl eine Reihe von Humanpathogenen nicht kultiviert werden können. Bei kulturpositiven Proben dauert die Durchführung des antimikrobiellen Resistenztests weitere 12 bis 24 Stunden.

    Aktuelle Point-of-Care-Molekulardiagnostik-Tests können identifizieren E coli und antimikrobielle Resistenz bei den identifizierten Stämmen viel schneller als Kultur- und Sensitivitätstests. Microarray-basierte Plattformen können spezifische pathogene Stämme von E coli und E coli-spezifische AMR-Gene in zwei Stunden oder weniger mit hoher Sensitivität und Spezifität, aber die Größe des Testpanels (d. h. Gesamterreger und antimikrobielle Resistenzgene) ist begrenzt. Neuere Metagenomik-basierte Diagnoseplattformen für Infektionskrankheiten werden derzeit entwickelt, um die verschiedenen Einschränkungen der Kultur und aller derzeit verfügbaren molekularen Diagnosetechnologien zu überwinden.

    Behandlung Bearbeiten

    Die Hauptstütze der Behandlung ist die Beurteilung der Dehydratation und der Ersatz von Flüssigkeit und Elektrolyten. Es hat sich gezeigt, dass die Verabreichung von Antibiotika den Krankheitsverlauf und die Dauer der Ausscheidung von enterotoxigenen . verkürzt E coli (ETEC) bei Erwachsenen in Endemiegebieten und bei Reisedurchfall, obwohl die Resistenzrate gegen häufig verwendete Antibiotika zunimmt und sie im Allgemeinen nicht empfohlen werden. [87] Das verwendete Antibiotikum hängt von den Anfälligkeitsmustern in der jeweiligen geografischen Region ab. Derzeit sind die Antibiotika der Wahl Fluorchinolone oder Azithromycin, wobei Rifaximin eine neue Rolle spielt. Orales Rifaximin, ein halbsynthetisches Rifamycin-Derivat, ist ein wirksames und gut verträgliches Antibiotikum zur Behandlung von Erwachsenen mit nicht-invasivem Reisedurchfall. Rifaximin war bei der Verkürzung der Durchfalldauer signifikant wirksamer als Placebo und nicht weniger wirksam als Ciprofloxacin. Während Rifaximin bei Patienten mit E coli-vorherrschende Reisediarrhoe, es scheint bei Patienten, die mit entzündlichen oder invasiven Enteropathogenen infiziert sind, unwirksam zu sein. [88]

    Prävention Bearbeiten

    ETEC ist die Art von E coli auf die sich die meisten Impfstoffentwicklungsbemühungen konzentrieren. Antikörper gegen die LT und die wichtigsten CF von ETEC bieten Schutz gegen LT-produzierende, ETEC-exprimierende homologe CF. Es wurden orale inaktivierte Impfstoffe entwickelt, die aus Toxin-Antigen und ganzen Zellen bestehen, d. h. der lizenzierte rekombinante Cholera-B-Untereinheit (rCTB)-WC-Cholera-Impfstoff Dukoral. Derzeit gibt es keine zugelassenen Impfstoffe für ETEC, obwohl sich mehrere in unterschiedlichen Entwicklungsstadien befinden. [89] In verschiedenen Studien bot der rCTB-WC-Cholera-Impfstoff einen hohen (85–100 %) kurzfristigen Schutz. Ein oraler ETEC-Impfstoffkandidat bestehend aus rCTB und inaktiviertem Formalin E coli Bakterien, die schwere CF exprimieren, haben sich in klinischen Studien als sicher, immunogen und wirksam gegen schweren Durchfall bei amerikanischen Reisenden erwiesen, jedoch nicht gegen ETEC-Durchfall bei kleinen Kindern in Ägypten. Ein modifizierter ETEC-Impfstoff bestehend aus rekombinantem E coli Stämme, die die wichtigsten CF überexprimieren, und ein eher LT-ähnliches Hybridtoxoid namens LCTBA werden derzeit klinisch getestet. [90] [91]

    Andere bewährte Präventionsmethoden für E coli Die Übertragung umfasst Händewaschen und verbesserte sanitäre Einrichtungen und Trinkwasser, da die Übertragung durch fäkale Kontamination von Nahrungsmitteln und Wasservorräten erfolgt.Darüber hinaus sind das gründliche Garen von Fleisch und der Verzicht auf rohe, nicht pasteurisierte Getränke wie Säfte und Milch weitere bewährte Methoden zur Vorbeugung E coli. Vermeiden Sie schließlich eine Kreuzkontamination von Utensilien und Arbeitsräumen bei der Zubereitung von Speisen. [92]

    Aufgrund seiner langen Geschichte der Laborkultur und der einfachen Handhabung E coli spielt eine wichtige Rolle in der modernen Biotechnologie und industriellen Mikrobiologie. [93] Die Arbeit von Stanley Norman Cohen und Herbert Boyer in E coli, das Plasmide und Restriktionsenzyme verwendet, um rekombinante DNA zu erzeugen, wurde zu einer Grundlage der Biotechnologie. [94]

    E coli ist ein sehr vielseitiger Wirt für die Produktion heterologer Proteine, [95] und es wurden verschiedene Proteinexpressionssysteme entwickelt, die die Produktion rekombinanter Proteine ​​in E coli. Forscher können Gene in die Mikroben einführen, indem sie Plasmide verwenden, die eine hochgradige Proteinexpression ermöglichen, und ein solches Protein kann in industriellen Fermentationsverfahren in Massenproduktion hergestellt werden. Eine der ersten nützlichen Anwendungen der rekombinanten DNA-Technologie war die Manipulation von E coli Humaninsulin herzustellen. [96]

    Viele Proteine, die bisher für schwierig oder unmöglich gehalten wurden, sind in E coli in gefalteter Form wurden erfolgreich ausgedrückt in E coli. Proteine ​​mit multiplen Disulfidbindungen können beispielsweise im periplasmatischen Raum oder im Zytoplasma von Mutanten produziert werden, die ausreichend oxidierend sind, um die Bildung von Disulfidbindungen zu ermöglichen, [97] während Proteine, die eine posttranslationale Modifikation wie Glykosylierung für Stabilität oder Funktion erfordern, mit dem N-verknüpften Glykosylierungssystem von Campylobacter jejuni eingearbeitet in E coli. [98] [99] [100]

    Geändert E coli Zellen wurden in der Impfstoffentwicklung, Bioremediation, Produktion von Biokraftstoffen, [101] Beleuchtung und Produktion von immobilisierten Enzymen verwendet. [95] [102]

    Stamm K-12 ist eine mutierte Form von E coli das das Enzym Alkalische Phosphatase (ALP) überexprimiert. [103] Die Mutation entsteht durch einen Defekt im Gen, das ständig für das Enzym kodiert. Ein Gen, das ein Produkt ohne jegliche Hemmung produziert, wird als konstitutive Aktivität bezeichnet. Diese besondere mutierte Form wird verwendet, um das zuvor erwähnte Enzym zu isolieren und zu reinigen. [103]

    Stamm OP50 von Escherichia coli dient zur Wartung von Caenorhabditis elegans Kulturen.

    Der Stamm JM109 ist eine mutierte Form von E coli das ist recA und endA mangelhaft. Der Stamm kann für das Blau/Weiß-Screening verwendet werden, wenn die Zellen das Fertilitätsfaktor-Episom tragen. [104] Ein Mangel an recA verringert die Möglichkeit einer unerwünschten Restriktion der interessierenden DNA und ein Mangel an endA hemmt die Zersetzung der Plasmid-DNA. Somit ist JM109 für Klonierungs- und Expressionssysteme nützlich.

    Modellorganismus Bearbeiten

    E coli wird häufig als Modellorganismus in mikrobiologischen Studien verwendet. Kultivierte Stämme (z.B. E coli K12) sind gut an die Laborumgebung angepasst und haben im Gegensatz zu Wildtyp-Stämmen ihre Fähigkeit, im Darm zu gedeihen, verloren. Viele Laborstämme verlieren ihre Fähigkeit, Biofilme zu bilden. [105] [106] Diese Merkmale schützen Wildtyp-Stämme vor Antikörpern und anderen chemischen Angriffen, erfordern jedoch einen hohen Energie- und Materialaufwand. E coli wird häufig als repräsentativer Mikroorganismus bei der Erforschung neuer Wasseraufbereitungs- und Sterilisationsverfahren, einschließlich Photokatalyse, verwendet. Durch Standard-Plattenzählmethoden, nach sequentiellen Verdünnungen und Wachstum auf Agargelplatten, kann die Konzentration lebensfähiger Organismen oder KBE (Kolonie bildende Einheiten) in einem bekannten Volumen behandelten Wassers bewertet werden, was eine vergleichende Bewertung der Materialleistung ermöglicht. [107]

    1946 beschrieben Joshua Lederberg und Edward Tatum erstmals das Phänomen, das als bakterielle Konjugation bekannt ist E coli als Modellbakterium, [108] und es bleibt das primäre Modell zur Untersuchung der Konjugation. [109] E coli war ein wesentlicher Bestandteil der ersten Experimente zum Verständnis der Phagengenetik, [110] und frühe Forscher wie Seymour Benzer nutzten E coli und Phagen T4, um die Topographie der Genstruktur zu verstehen. [111] Vor Benzers Forschung war nicht bekannt, ob das Gen eine lineare Struktur oder ein Verzweigungsmuster aufweist. [112]

    E coli war einer der ersten Organismen, dessen Genom das komplette Genom von E coli K12 wurde veröffentlicht von Wissenschaft 1997 [55]

    Von 2002 bis 2010 schuf ein Team der Ungarischen Akademie der Wissenschaften einen Stamm von Escherichia coli genannt MDS42, das jetzt von Scarab Genomics aus Madison, WI unter dem Namen "Clean Genome. E.coli" vertrieben wird, [113] wobei 15% des Genoms des Elternstamms (E. coli K-12 MG1655) waren entfernt, um die Effizienz der Molekularbiologie zu unterstützen, indem IS-Elemente, Pseudogene und Phagen entfernt werden, was zu einer besseren Erhaltung von Plasmid-kodierten toxischen Genen führt, die oft durch Transposons inaktiviert werden. [114] [115] [116] Biochemie und Replikationsmaschinerie wurden nicht verändert.

    Durch die Bewertung der möglichen Kombination von Nanotechnologien mit Landschaftsökologie können komplexe Habitatlandschaften mit Details auf der Nanoskala generiert werden. [117] An solchen synthetischen Ökosystemen wurden evolutionäre Experimente mit E coli wurden durchgeführt, um die räumliche Biophysik der Anpassung in einer Inselbiogeographie auf dem Chip zu untersuchen.

    Es werden auch Studien durchgeführt, in denen versucht wird, zu programmieren E coli um komplizierte mathematische Probleme zu lösen, wie das Hamiltonsche Wegproblem. [118]

    In anderen Studien nicht pathogen E coli wurde als Modellmikroorganismus verwendet, um die Auswirkungen simulierter Mikrogravitation (auf der Erde) auf denselben zu verstehen. [119] [120]

    1885 entdeckte der deutsch-österreichische Kinderarzt Theodor Escherich diesen Organismus im Kot gesunder Menschen. Er hat es genannt Bakterium coli kommune weil es im Dickdarm gefunden wird. Frühe Klassifikationen von Prokaryoten ordneten diese aufgrund ihrer Form und Beweglichkeit in eine Handvoll Gattungen ein (damals gab es Ernst Haeckels Klassifizierung der Bakterien im Königreich Monera). [91] [121] [122]

    Bakterium coli war die Typusart der nun ungültigen Gattung Bakterium als sich herausstellte, dass die ehemalige Typusart ("Bakterium triloculare") fehlte. [123] Nach einer Überarbeitung von Bakterium, es wurde umklassifiziert als Bacillus coli von Migula im Jahr 1895 [124] und später in die neu geschaffene Gattung umklassifiziert Escherichia, benannt nach seinem ursprünglichen Entdecker. [125]

    1996 der weltweit schlimmste Ausbruch von E coli In Wishaw, Schottland, kam es zu einer Lebensmittelvergiftung, bei der 21 Menschen starben. [126] Diese Zahl der Todesopfer wurde 2011 überschritten, als der Ausbruch von E. coli O104:H4 in Deutschland 2011 im Zusammenhang mit organischen Bockshornklee-Sprossen 53 Menschen tötete.


    Diskussion

    In dieser Studie wurden die lichtbetriebenen Systeme BANA und BARNA konstruiert und eingesetzt, um die Zellteilung von E coli. Als das lichtbetriebene BANA-System verwendet wurde, um die Zellteilung von E coli DN4, der SSA- und Acetoin-Titer von E coli DN4 wurden auf 3,7 μm −1 und 67,2 g L −1 erhöht, was 20,39 bzw. 39,19 % höher war als diese von E coli D1 bzw. Als das lichtbetriebene BARNA-System verwendet wurde, um die Zellteilung von E coli DQ8, der MCV-, PLH-Gehalt, DCW- und PLH-Titer von E coli DQ8 wurde auf 52,6 μm 3 , 53,8 Gew.-%, 26,6 und 14,31 g L −1 erhöht, was 13,65-fach, 2,01-fach, 1,18-fach und 2,38-fach höher war als diese von E coli DQ0 bzw. Diese Ergebnisse zeigten, dass das Engineering der C- und D-Perioden der Zellteilung eine nützliche Strategie darstellt, um die Effizienz mikrobieller Zellfabriken zu optimieren.

    Zellteilung in Escherichia coli wird durch einen großen Proteinkomplex und Desoxyribonukleotide 31,37 vermittelt, die durch zwei Faktoren reguliert werden: (i) ein positiver Regulator: der nrdAB, nrdA, nrdB, und nrdD Gene in der C-Phase der Zellteilung katalysieren Desoxyribonukleosiddiphosphat für die dNTP-Produktion, um die DNA-Replikation für die Zellteilung zu fördern, und dann ftsZA, ftsZ, ftsA, ftsN, und ftsQ Gene in der D-Phase der Zellteilung bauen sich zu einem Z-Ring-Gerüst zusammen, um die Zellteilung zu beschleunigen (ii) ein negativer Regulator: die Deletion des nrdAB, nrdA, nrdB, und nrdD Gene in der C-Phase der Zellteilung können die dNTP-Synthese stören sulA, minC, minD, minE, und ftsH Gene in der D-Phase der Zellteilung sind die Hemmstoffe der Zellteilung. Um die Zellteilung auf mehreren Ebenen zu regulieren, ist die Optogenetik eine vielversprechende Strategie auf nichtinvasive, reversible und raumzeitliche Weise 33 . Zum Beispiel wurde ein Blaulicht-Feedback-Gen-Schaltkreis verwendet, um die Pyruvat-Decarboxylierung reversibel zu regulieren, um das Zellwachstum und die chemische Produktion zu entkoppeln, was zu einer Isobutanol- und 2-Methyl-1-butanol-Produktion von bis zu 8,49 g L −1 und 2,38 g L −1 führte. bzw. 33. Darüber hinaus wurden rotes Licht und blaues Licht verwendet, um die Bphs- und BlrP1-Proteine ​​für die Biofilmbildung zu regulieren 44 . Basierend auf diesen Studien wurde eine optogenetikbasierte Zellteilungsstrategie vorgeschlagen: Die optogenetische Strategie wurde verwendet, um die C+D-Phase der Zellteilung zu verkürzen oder zu verlängern, indem die Gene, die an den C+D-Phasen der Zellteilung in verschiedenen Phasen beteiligt sind, räumlich-zeitlich gesteuert werden mit verschiedenen Beleuchtungsstärken und -zeiten. So wurden zwei verschiedene lichtbetriebene Systeme, BANA und BARNA, konstruiert. Für die schwache Expression von . wurde ein lichtbetriebenes BARNA-System verwendet nrdA und Überexpression von nrdAB, ftsZA, und sulA in E coli DQ8 und damit die C- und D-Phasen der Zellteilung wurden verlängert. Als Ergebnis verursacht dieses System den Minizell-Phänotyp 29 und erhöht die Zellzahl und das Zellwachstum 30,45 . Um die DNA-Replikation zu verhindern und die Zellteilungsfrequenz zu verringern, wurde ein lichtbetriebenes BARNA-System für die schwache Expression von . verwendet nrdA und Überexpression von nrdAB, ftsZA, und sulA in E coli DQ8 und damit die C- und D-Phasen der Zellteilung wurden verlängert. Somit verursacht dieses System einen großzelligen Phänotyp und verringert die Zellzahl und das Zellwachstum 13,46 .

    Als lebenswichtiger physiologischer Parameter industrieller Mikroben 20,47 könnte SSA den Massentransfer durch Erhöhung der Nährstoffaufnahmerate und des Zellwachstums erhöhen und die Zelldichte durch Veränderung der Rheologie von Kulturen verbessern. Während der industriellen Fermentation kann SSA durch mechanischen Druck, Mediengehalte und chemischen Stress beeinflusst werden 16 . Daher haben viele Bemühungen ihr Anwendungspotenzial bei der Regulierung von SSA gezeigt, wie z. B. die Mikropartikelkultivierung 20 , die Fermentationsoptimierung 48 und die adaptive Evolutionstechnik im Labor 49 . Basierend auf diesen Strategien wird die Effizienz der chemischen Produktion durch die Erhöhung der SSA von industriellen Mikroben gesteigert. In dieser Studie, als die C- und D-Zellteilungsperioden durch BANA verkürzt wurden, wurde die SSA um 20,39 % erhöht. Als Ergebnis wurde der Acetoin-Titer um 39,19 % im Vergleich zu dem von erhöht E coli D1. Diese Ergebnisse zeigten, dass die Acetoinproduktion durch die genaue Kontrolle der Zellteilung und die Entwicklung von SSA verbessert wurde. Diese Studie unterschied sich von den vorherigen Studien, in denen gezielte Stoffwechselwege verändert wurden 41 und die Repression von Kohlenstoffkataboliten eliminiert wurde 50 .

    Der MCV industrieller Mikroben ist ein wichtiger physiologischer Parameter 51 , bei dem wir die Produktion von Einschlusskörperchen maximieren wollen. Darüber hinaus sollte auch in Betracht gezogen werden, dass MCV die Effizienz der vor- und nachgelagerten Bioprozessierung durch schnellere Ausfällung von Zellen mit relativ höherer Schwerkraft verbessert. Um das MCV industrieller Mikroben zu manipulieren, wurde eine Reihe von Strategien entwickelt, wie die Störung der Peptidoglycan-Zellwandsynthese, um eine elastischere und flexiblere Zellstruktur zu erhalten 24 , das Screening der Zytoskelett-Mutanten auf morphologische Eigenschaften 25 und die Störung der Phosphatidylinositol-Biosynthese in vivo zur Bildung fadenförmiger Strukturen 23 . In dieser Studie, als die C- und D-Phasen der Zellteilung durch lichtbetriebene BARNA-Systeme verlängert wurden, wurde das MCV von E coli DQ8 zeigte einen 13,65-fachen Anstieg. Als Ergebnis wurde der Zellraum für die PLH-Akkumulation vergrößert und somit der PLH-Gehalt von E coli DQ8 wurde im Vergleich zu . um das 2,01-fache erhöht E coli DQ0. Diese Ergebnisse zeigten, dass die PLH-Produktion durch genaue Regulierung der C- und D-Phasen der Zellteilung verbessert wurde, um das MCV von . zu erhöhen E coli DQ8. Schwacher Ausdruck von nrdA könnte die C-Phase der Zellteilung verlängern, indem sie die intrazelluläre dNTP-Synthese und DNA-Replikation sowie die Überexpression von sulA könnte die D-Periode der Zellteilung verlängern, indem sie die Z-Ring-Bildung und die divisomische Anordnung behindert 46 . Somit würde die Zellteilungshäufigkeit durch eine Verlängerung der Zellteilung 29 beeinflusst, was zu einer Zunahme der Zellgröße führen würde. Der größere Zellraum für die PLH-Akkumulation verbesserte den PLH-Gehalt, Titer und DCW. Die Strategie in dieser Studie unterschied sich von den vorherigen Strategien, wie z. B. das Engineering der Zielstoffwechselwege 52 , die Nutzung des posttranslationalen metabolischen Switching 53 und die Kontrolle des Cofaktorverhältnisses 54 .

    In dieser Studie wurde eine optogenetikbasierte Zellteilungsstrategie entwickelt, die nichtinvasiv ist und räumliche, zeitliche und reversible Kontrolle beinhaltet. Die SSA und MCV von E coli wurden durch Verkürzung oder Verlängerung der C- und D-Phasen der Zellteilung unter Verwendung eines lichtbetriebenen BANA- bzw. BRANA-Systems erhöht. Auf dieser Grundlage führten die höheren SSA- oder MCV-Werte zu einer höheren Effizienz der Acetoin- oder PLH-Produktion. Unsere Ergebnisse zeigten, dass eine Erhöhung von SSA und MCV durch Manipulation der Zellteilung die gezielte chemische Produktion verbessern könnte. Darüber hinaus kann diese optogenetisch-basierte Zellteilungsstrategie einen Ansatz zum Aufbau mikrobieller Zellfabriken für die hochwertige chemische Produktion bieten.


    E. Coli-Bakterien: eine zukünftige Energiequelle?

    Für die meisten Menschen ist der Name "E. coli" gleichbedeutend mit Lebensmittelvergiftung und Produktrückrufen, aber ein Professor der Chemieingenieurabteilung der Texas A&M University sieht die Bakterien als zukünftige Energiequelle vor, die dazu beiträgt, unsere Autos, Häuser und mehr anzutreiben.

    Durch genetische Modifikation der Bakterien hat Thomas Wood, Professor am Artie McFerrin Department of Chemical Engineering, einen E. coli-Stamm so "gezwickt", dass er erhebliche Mengen an Wasserstoff produziert. Insbesondere produziert Woods Stamm 140-mal mehr Wasserstoff als in einem natürlich vorkommenden Prozess erzeugt wird, so ein Artikel in "Microbial Biotechnology", der seine Forschung detailliert beschreibt.

    Obwohl Wood anerkennt, dass noch viel zu tun ist, bevor seine Forschung in eine kommerzielle Anwendung überführt wird, könnte sich sein anfänglicher Erfolg als wichtiges Sprungbrett auf dem Weg zur wasserstoffbasierten Wirtschaft erweisen, von der viele glauben, dass sie in diesem Land ist Zukunft.

    Erneuerbar, sauber und effizient ist Wasserstoff der Schlüsselbestandteil der Brennstoffzellentechnologie, die das Potenzial hat, alles von tragbarer Elektronik über Autos bis hin zu ganzen Kraftwerken anzutreiben. Heute wird der größte Teil des weltweit produzierten Wasserstoffs durch einen Prozess erzeugt, der als „Cracking Water“ bekannt ist, bei dem Wasserstoff vom Sauerstoff getrennt wird. Doch das Verfahren ist teuer und benötigt viel Energie – einer der Hauptgründe, warum sich die Technologie erst noch durchsetzen muss.

    Woods Arbeit mit E. coli könnte das ändern.

    Während die Öffentlichkeit es gewohnt ist, von dem sehr spezifischen Stamm zu hören, der beim Menschen eine Lebensmittelvergiftung verursachen kann, sind die meisten Stämme häufig und harmlos und helfen sogar ihren Wirten, indem sie verhindern, dass andere schädliche Bakterien im menschlichen Darmtrakt Wurzeln schlagen.

    Und die Verwendung von E. coli in der Wissenschaft ist nichts Neues, da es bei der Herstellung von Humaninsulin und bei der Entwicklung von Impfstoffen verwendet wurde.

    Aber als potentielle Energiequelle?

    Das ist Neuland und wird von Wood und seinen Kollegen vorangetrieben.

    Durch das selektive Löschen von sechs spezifischen Genen in der DNA von E. coli hat Wood das Bakterium im Grunde in eine Mini-Fabrik zur Wasserstoffproduktion verwandelt, die mit Zucker betrieben wird. Wissenschaftlich gesehen hat Wood den natürlich vorkommenden Prozess der Glukoseumwandlung der Bakterien massiv verbessert.

    "Diese Bakterien haben 5.000 Gene, die es ihnen ermöglichen, Umweltveränderungen zu überleben", erklärte Wood. „Wenn wir Dinge ausschalten, verlieren die Bakterien ihre Konkurrenz. Wir haben ihnen nicht die Fähigkeit gegeben, etwas zu tun. Sie gewinnen hier nichts, was sie verlieren. Die Bakterien, die wir herstellen, sind weniger wettbewerbsfähig und weniger schädlich, weil was entfernt wurde."

    Mit Zucker als Hauptenergiequelle kann dieser E. coli-Stamm jetzt die bestehenden und sich ständig erweiternden wissenschaftlichen Verfahren nutzen, die darauf abzielen, Zucker aus bestimmten Pflanzen wie Mais herzustellen, sagte Wood.

    "Viele Leute arbeiten daran, etwas, das man anbaut, in eine Art Zucker umzuwandeln", erklärte Wood. „Wir wollen diesen Zucker nehmen und zu Wasserstoff machen. Wir werden Zucker irgendwo aus einer Ernte gewinnen.

    Biologische Methoden wie diese (E. coli produzieren Wasserstoff durch einen fermentativen Prozess) werden wahrscheinlich die Energiekosten senken, da diese Prozesse keine umfangreiche Heizung oder Elektrizität erfordern“, sagte Wood.

    "Eines der schwierigsten Dinge in der chemischen Verfahrenstechnik ist, wie man das Produkt bekommt", erklärte Wood. "In diesem Fall ist es sehr einfach, weil der Wasserstoff ein Gas ist und einfach aus der Lösung sprudelt. Sie fangen das Gas einfach auf, wenn es aus dem Glas kommt. Das war's. Sie haben reinen Wasserstoff."

    Es gibt auch andere Vorteile.

    Erwartungsgemäß sind die Kosten für den Bau einer völlig neuen Pipeline zum Transport von Wasserstoff eine erhebliche Abschreckung für die Nutzung der wasserstoffbasierten Brennstoffzellentechnologie. Darüber hinaus besteht auch ein erhöhtes Risiko beim Transport von Wasserstoff.

    Die Lösung besteht laut Wood darin, Wasserstoff vor Ort umzuwandeln.

    „Wir glauben vor allem, dass man Dinge wie Zucker transportieren kann und wenn man den Zucker verschüttet, gibt es keine große Katastrophe“, sagte Wood. "Die Idee ist, den Wasserstoff dort zu machen, wo man ihn braucht."

    All dies ist natürlich auf der Straße.Im Moment bleibt Wood im Labor beschäftigt und arbeitet an der Verfeinerung eines Prozesses, der bereits auf sein unglaubliches Potenzial hingewiesen hat. Ziel sei es, aus weniger mehr herauszuholen.

    »Nehmen Sie zum Beispiel Ihr Haus«, sagte Wood. "Die Größe des Reaktors, den wir heute brauchen würden, wenn wir diese Technologie implementieren würden, wäre kleiner als die Größe eines 250-Gallonen-Kraftstofftanks, der in einem typischen Ostküstenhaus zu finden ist. Ich bin noch nicht fertig damit, aber bei" Wenn wir die Technologie jetzt jetzt implementieren, müssten Sie oder eine Maschine täglich etwa das Gewicht eines Menschen einschaufeln, damit der Reaktor genug Wasserstoff liefern könnte, um ein durchschnittliches amerikanisches Haus 24 Stunden lang zu versorgen.

    "Wir versuchen, Bakterien herzustellen, damit keine 80 Kilogramm benötigt werden, sondern eher 8 Kilogramm."

    Quelle der Geschichte:

    Materialien zur Verfügung gestellt von Texas A&M University. Hinweis: Der Inhalt kann hinsichtlich Stil und Länge bearbeitet werden.


    Materialen und Methoden

    Stämme und Medien

    Sofern nicht anders angegeben, ist der Stamm, der zur Charakterisierung genetischer Schaltkreise verwendet wird, E coli MG1655 (Nummerierung basiert auf der Genomsequenz, NCBI U00096.3 Blattner et al, 1997). Plasmid-Engineering wurde unter Verwendung von E coli DH10β (New England Biolabs, USA, C3019H) oder E coli DH5α (New England Biolabs, USA, C2988J). E coli TransforMax™ EC100D™ pir + (Lucigen, USA, CP09500)) und E coli JTK164A (Kittleson) et al, 2011) wurden für Plasmide verwendet, die den R6K-Replikationsursprung enthalten. Zur Konjugation, E coli S17-1 λpir-Stamm (TpR, SmR, recA, dies, Profi, hsdR-M+RP4: 2-Tc:Mu:Km Tn7 λpir) wurde als Donorstamm verwendet, um Plasmide mit R6K-Replikationsursprung und OriT zu liefern. Für das Zellwachstum und die Klonierung wurden LB-Medien (BD Biosciences, USA, BD244610) verwendet. 2xYT-Medien (BD Biosciences, USA, DF0440-17) wurden verwendet, um Zellen für die Plasmidextraktion mit dem QIAprep Spin Miniprep Kit (Qiagen, USA, 27104) zu züchten. Elektrokompetente Zellen wurden in SOB-Medien (Teknova, USA, S0210) präpariert. SOC-Wiedergewinnungsmedien (New England Biolabs, USA, B9020S) wurden verwendet, um Zellen nach der Transformation zu gewinnen. M9-Medien bestehen aus M9-Minimalsalz (Sigma-Aldrich, USA, M6030), ergänzt mit 0,034% Thiamin (Fisher Scientific, USA, BP892-100), 0,4% Glucose (Fisher Chemical, USA, M-10046U) und 0,2% Casaminosäuren (BD Biosciences, USA, 223050). Diese Medien (im Folgenden als „M9-Medien“ bezeichnet) wurden für alle Messungen und Charakterisierungen verwendet, sofern nicht anders angegeben. Folgende Antibiotika werden verwendet: Ampicillin (100 µg/ml, Amp) (GoldBio, USA, A-301-5), Chloramphenicol (34 µg/ml, Cm) (Alfa Aesar, USA, AAB20841-14), Kanamycin (50 µg/ml, Kan) (GoldBio, USA, K-120-10), Spectinomycin (40 µg/ml, Sp) (MP Biomedicals LLC, USA, 158993) und Tetracyclin (5 µg/ml, Tet) (GoldBio, USA, T-101-25). Alle Oligonukleotide, Gblocks und Oligos wurden von IDT (Integrated DNA Technologies, USA Appendix Abb. S14 und Appendix Tables S4–S8) bestellt.

    Terminatoridentifikation aus Genomsequenzen

    Kandidatenterminatoren wurden aus dem E coli MG1655-Genom (NCBI RefSeq: NC_000913) unter Verwendung von RNIE Version 0.01 mit Standardeinstellungen und dem Terminatormodell „genome.cm“ (Gardner et al, 2011). Dies erzeugte eine Ausgabe-GFF-Datei, die den Ort (Start- und Endbasenpaar), die Orientierung (Sense- oder Antisense-Strang) und die Bewertungsstatistik für jeden mutmaßlichen Terminatorteil enthält. Um die Stärke jedes mutmaßlichen Terminators zu beurteilen, wurden Transkriptionsprofile sowohl für Sense- als auch Antisense-Stränge des MG1655-Genoms aus den rohen RNA-Seq-Reads erstellt (Gorochowski et al, 2017). Als nächstes wurde für jeden mutmaßlichen Terminator das geeignete Transkriptionsprofil für den Sense- oder Antisense-Strang (je nach Orientierung des Terminators) ausgewählt. Die Terminatorstärke wurde dann geschätzt, indem die durchschnittliche Transkriptionsprofilhöhe für die 25-bp-Region vor und nach der Position des Terminators gemessen wurde (um lokalisierte Fluktuationen auszugleichen) und das Verhältnis der durchschnittlichen Transkriptionsprofilhöhe direkt nach dem Terminator zu direkt davor berechnet wurde . Schließlich werden die Terminatoren, die zuvor in anderen Arbeiten verwendet wurden (Chen et al, 2013 ) wurden herausgefiltert und eine abschließende Rangliste der Terminatoren nach Terminierungsstärke erstellt.

    Messung der Abschlusswiderstandsstärke

    Terminatoren wurden nach einem zuvor veröffentlichten Assay (Chen et al, 2013). Sie wurden in das pGR-Plasmid kloniert (Anhang Abb. S14, Anhang Abb. S1, Anhang Tabellen S1 und S5).. Escherichia coli DH5α mit pGR-Plasmiden mit einem Terminator (pGR-DT#) wurde über Nacht in 200 µl LB-Medium mit Ampicillin (100 µg/ml) kultiviert. Zellen wurden unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) in einem ELMI Digital Thermo Microplate Shaker Incubator (ELMI Ltd, Lettland, nachstehend "ELMI Plate Shaker") kultiviert. Am nächsten Tag wurden die Zellen in 200 µl frischem LB-Medium mit Ampicillin (100 µg/ml) und 12,5 mM L-Arabinose (Sigma-Aldrich, USA, A3256) 200-fach verdünnt. Die Zellen wurden für 3 h bei 37 °C und 1.000 U/min in einem ELMI-Plattenschüttler induziert. Nach der Induktion wurden die Fluoreszenzniveaus mit Durchflusszytometrie analysiert und das geometrische Mittel von GFP (FITC-A) und RFP (PE-Texas-RED-A) wurde mit der Software FlowJo (TreeStar, Inc., USA) berechnet. Diese geometrischen Mittel wurden dann verwendet, um die Terminatorstärke zu berechnen, TS = [(<GFP>Begriff/<RFP>Begriff)/(<GFP>ref/<RFP>ref)]. Die <RFP>Begriff und <GFP>Begriff bezeichnen das geometrische Mittel, das für Zellen berechnet wurde, die den Plasmidterminator enthalten, nachdem die Autofluoreszenz abgezogen wurde. Die <RFP>ref und <GFP>ref bezeichnen das geometrische Mittel, das mit dem pGR-Plasmid ohne einen Terminator zwischen GFP und RFP nach Abzug der Autofluoreszenz berechnet wurde.

    Durchflusszytometrie-Analyse

    Die Zytometrie wurde unter Verwendung eines LSRII Fortessa-Durchflusszytometers (BD Biosciences, USA) durchgeführt. Nach der Ernte wurden die Zellen in 200 μl 1× PBS verdünnt ([NaCl]: 137 mM, [KCl]: 2,7 mM, [Na2HPO4]: 10 mM und [KH2Bestellung4]: 1,8 mM) mit 2 mg/ml Kanamycin. Es wurden eine FSC-Spannung von 437 V, eine SSC-Spannung von 289 V, eine grüne Laserspannung (488 nm) von 425 V und eine rote Laserspannung (561 nm) von 489 V verwendet. Für jede Probe wurden > 30.000 Ereignisse aufgezeichnet. Die aufgezeichneten Durchflusszytometriedaten wurden mit der Software FlowJo weiter analysiert. Die Medianwerte von FITC-A und PE-Texas Red-A wurden verwendet, um die Expressionsniveauverteilung innerhalb einer Population darzustellen.

    Konstruktion einer Tn5-Transposon-Bibliothek

    Das plYJP017-Plasmid, das eine konstitutiv exprimierte mCherry-Sonde enthält, wurde durch Modifizieren des pBAMD1-4-Plasmids (Martinez-Garcia et al, 2014). Um ständige zu verhindern tnpA Ausdruck aus der Backbone-Integration, sfGFP wurde dem Rückgrat als Gegenselektionsmarker hinzugefügt (Abb. 1b). Escherichia coli S17-1 λpir elektrokompetente Zellen wurden mit dem plYJP017 Plasmid transformiert. Der Stamm mit dem plYJP017-Plasmid wurde dann zur Konjugation mit E coli DH10β trägt einen Tetracyclin (Tet)-Resistenzmarker (tetA) im Genom (YJP_DHC404 Anhang Abb. S14). Spenderstämme (E coli S17-1 λpir) und Empfängerstämme (E coli DH10&bgr;) wurden separat über Nacht in 200 &mgr;l LB-Medium mit Antibiotika bei 37 °C und 1000 Upm unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) in einem ELMI-Plattenschüttler gezüchtet. Am nächsten Tag wurden die Zellen 200-fach in 4 ml LB-Medium mit Antibiotika verdünnt und 2,5 h bei 37 °C bei 250 UpM in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) inkubiert. Wenn Zellen OD . erreichten600 = 0,4 wurden 250 &mgr;l sowohl Spender- als auch Empfängerzellen gemischt. Die Zellen wurden dann vorsichtig zentrifugiert (8.000 g, 25°C) und mit 1 ml LB ohne Antibiotika viermal bei Raumtemperatur gewaschen. Schließlich wurden Zellpellets mit 50 µl SOC-Wiederherstellungsmedium resuspendiert und auf eine einfache LB-Agarplatte (7 µl pro Spot) getüpfelt. Gefleckte LB-Agarplatten wurden 5 h bei 37 °C inkubiert. Die Zellen wurden dann gesammelt und in 1 ml SOC-Wiedergewinnungsmedium resuspendiert, gefolgt sofort von zwei zusätzlichen Verdünnungen (100-fach und 10.000-fach). Dann wurden 75 µl jeder verdünnten Zellsuspension auf LB-Agarplatten mit Spectinomycin (40 µg/ml) und Tetracyclin (5 µg/ml) ausplattiert. Am nächsten Tag wurden einzelne Kolonien von Platten gepickt und in 200 &mgr;l M9-Medium für 5,5 h bei 37 °C und 1000 Upm in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) gezüchtet. Nach der Inkubation wurden die Zellen mit Durchflusszytometrie analysiert, indem die Expressionsniveaus von GFP (FITC-A) und mCherry (PE-Texas RED) gemessen wurden. Nur Zellen, die mCherry, aber kein GFP aufweisen, wurden für die weitere Analyse verwendet, um die Insertionsstelle zu bestimmen. Für jede Kolonie wurde die Insertionsstelle durch Amplifizieren der Verbindung zwischen der inserierten DNA und der benachbarten genomischen DNA bestimmt. Ein randomisierter Primer (oYJP1741: GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC) und ein Insertions-spezifischer Primer (oYJP1745: CTTGGCCTCGCGCGCAGATCAG Martinez-Garcia et al, 2014) wurden verwendet, um die Verbindung mit zwei aufeinanderfolgenden Runden von PCR-Amplifikationen zu amplifizieren. Jede Kolonie wurde in Wasser suspendiert und bei 95°C für 10 Minuten inkubiert, um die Zellen vollständig zu lysieren. Ein 1,25 µl Aliquot der Koloniesuspension wurde als PCR-Template zum PCR-Premix mit 12,5 µl 2× Phusion High-Fidelity Master Mix (New England Biolabs, USA, M0531), 10 µl Wasser, 1,25 µl 10 μM oYJP1741-Primer und 0,5 μl 10 μM oYJP1745-Primer. Die PCR-Produkte wurden dann mit einem internen Primer oYJP1746 (CACCAAGGTAGTCGGCAAAT) nach Sanger sequenziert und unter Verwendung von NCBI-Nukleotidblast ausgerichtet. Nur die Einfügungen mit einem eindeutigen Treffer wurden für die weitere Charakterisierung ausgewählt. Die mCherry-Expressionsniveaus und Wachstumsphänotypen wurden für jedes Mitglied der Tn5-Transposon-Bibliothek charakterisiert. Jeder Klon wurde auf LB-Agarplatten mit Spectinomycin (40 µg/ml) und Tet (5 µg/ml) ausgestrichen. Einzelne Kolonien wurden von Platten gepickt und über Nacht in M9-Medium ohne Antibiotika für 16 h bei 37 °C und 1.000 U/min in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) inokuliert. Die Zellen wurden 185-fach in 200 &mgr;l frischem M9-Medium verdünnt und für 3 h inkubiert. Die Zellen wurden erneut 700-fach in 200 &mgr;l frischem M9-Medium verdünnt und für 6 h wachsen gelassen. Nach 6 h Inkubation wurden 30 µl Zellen zu 200 µl 1x PBS-Lösung mit 2 mg/ml Kanamycin (Kan) gegeben und die Fluoreszenz mittels Durchflusszytometrie gemessen. Die optische Dichte (OD) der Kulturen bei 600 nm wurde gemessen. Dazu wurden 150 µl der Kultur auf eine optisch transparente Nunc™ 96-Well-Platte (Thermo Scientific, USA, 165305) überführt. Der Hybrid Microplate Reader BioTek Synergy H1 (BioTek Instruments Inc, USA) wurde verwendet, um die endgültige Extinktion der Kultur zu messen. Das relative Wachstum für jedes Mitglied der Bibliothek wurde durch relatives Wachstum = ((OD600: Tn5) − (OD600: leer))/(OD600: DH10β Tet) − (OD600: leer)), wobei OD600: Tn5, OD600: leer und OD600: DH10β Tet siehe OD600 eines Tn5-Bibliotheksmitglieds, leere M9-Medien und E coli DH10β mit dem Tetracyclin-Marker auf dem Genom.

    Computergestützte Suche nach mutmaßlichen Off-Target-Integrase-Sites

    Um potenzielle Off-Target-Sites für Integrase 2, 5 und 7 zu identifizieren, werden die veröffentlichten att B/P-Sites (Yang et al, 2014 ) (Anhang Tabellen S5 und S6) wurden in der E coli MG1655-Genom (NCBI U00096.3) mit Megablast (Zhang et al, 2000 ) und blastn (Altschul et al, 1997). Jede Stelle wurde getestet, ob sie (i) Übereinstimmungen mit dem Genom über Megablast aufweist, (ii) > 30% der Abfragesequenz über blastn abdeckt und (iii) eine Übereinstimmung mit signifikanter Überlappung aufweist (E-Wert < 0,1). Wenn eines dieser Kriterien zutraf, wurde die Site abgelehnt.

    Bau von genomischen Landeplätzen

    Zwei Methoden wurden verwendet, um die Landeplätze in das Genom einzufügen. Zwei Landepads (#1 und #2) wurden nacheinander unter Verwendung von λ-RED-Rekombination eingeführt (Datsenko & Wanner, 2000). E coli MG1655-Zellen, die Arabinose-induzierbare λ-RED-Rekombinase auf einem Plasmid mit einem temperaturempfindlichen Ursprung (pKD46 Datsenko & Wanner, 2000) beherbergen, wurden über Nacht unter Verwendung von Falcon 14-ml-Polypropylenröhrchen mit rundem Boden (Corning, USA, 352059) gezüchtet. Zellen wurden in 4 ml LB mit Amp (100 &mgr;g/ml) bei 30°C und 250 Upm in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) gezüchtet. Am nächsten Tag wurden die Zellen 200-fach in 25 ml frischem SOB-Medium in einem Erlenmeyerkolben mit Kerbboden mit Ampicillin (100 µg/ml) und 10 mM L-Arabinose verdünnt. Die Zellen wurden für drei Stunden bei 30°C und 250 U/min in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) induziert, bis sie OD . erreichten600 = 0,4. Die Zellen wurden dann zentrifugiert (4.700 g, 4 °C, 10 min) unter Verwendung einer Legend XFR-Zentrifuge (Thermo Scientific, USA). Die Zellpellets wurden dann mit 5 ml gekühltem 10 % Glycerin gewaschen und erneut bei 4.700 °C zentrifugiert g und 4°C für 10 min. Der Waschschritt wurde noch zweimal unter Verwendung von 1 ml gekühltem 10 % Glycerin wiederholt, und die Zellen wurden unter Verwendung einer gekühlten Tischzentrifuge (Eppendorf, USA) bei 21.000 °C pelletiert g und 4°C für 30 s. Schließlich wurden Zellpellets in 500 &mgr;l gekühltem 10 % Glycerin resuspendiert. Als nächstes wurden 200 &mgr;l dieser elektrokompetenten Zellen mit 150 ng Landeplatz-DNA unter Verwendung von Elektroporation (2.500 mA) (Eppendorf, USA) transformiert und durch Zugabe von 1 ml SOC-Wiederherstellungsmedium gewonnen und bei 30°C für 3 h inkubiert. Transformierte Zellen wurden dann auf LB-Agar (2%) mit Cm- (35 &mgr;g/ml) oder Kan (50 &mgr;g/ml) Antibiotika ausplattiert und über Nacht bei 30 °C inkubiert. Die Integration von Landepads wurde durch PCR-Amplifikation und Sequenzierung der genomischen Regionen, die Landepads enthalten, bestätigt. Für Landing Pad #1 wurden die amplifizierenden Primer oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) und oYJP3437 (AGGCGCTGGAAGCGCGCTTTGTGCTGGAAGATAAG) verwendet. Für Landing Pad #2 wurden die amplifizierenden Primer oYJP3525 (ACCAATTGGCGCGCGCTTCGCAATAAAATTCCCTTCG) und oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG) verwendet. Nach der Integration dieser beiden Landeplätze wurde das temperaturempfindliche Plasmid, das die λ-RED-Rekombinase beherbergte, entfernt, indem Zellen über Nacht bei 37 °C in LB ohne Amp (100 &mgr;g/ml) gezüchtet wurden. Nachdem die Landing Pads #1 und #2 erfolgreich integriert wurden, wurde Landing Pad #3 konstruiert und unter Verwendung einer ortsspezifischen Mini-Tn7-Transposase integriert (Choi & Schweizer, 2006). Zuerst wurde das Landing Pad #3 in das Plasmid plYJP072 kloniert (Anhang Fig. S14). Nächste, E coli S17-1 λpir elektrokompetente Zellen wurden mit plYJP072 transformiert und der resultierende Stamm wurde mit zwei verschiedenen Stämmen zur biparentalen Paarung konjugiert. Diese beiden Stämme bestehen aus einem Stamm, der Tn7-Transposase-kodierende Plasmide beherbergt, und dem Stamm, der die Landing Pads Nr. 1 und Nr. 2 enthält (oben beschrieben). Die konjugierten Zellen wurden auf LB-Agarplatten (2%) mit Cm (35 µg/ml) oder Kan (50 µg/ml) und Tet (5 µg/ml) Antibiotika ausplattiert. Die Insertion von Landing Pad #3 wurde durch PCR-Amplifikation und Sequenzierung genomischer Regionen, die das Landing Pad umfassen, unter Verwendung der PCR-Primer oYJP2826 (AGAGATGACAGAAAAATTTTCATTCTGTGACAGAGAGAAAAAGTAGCCGAAGATG) und oYJP2827 (CCGCGTAACCTGGCAAAATCGGTTACGGTTGAGTAA) bestätigt. Nachdem die Landepads eingefügt wurden, wurde eine Phagentransduktion verwendet, um sie in einen sauberen genomischen Hintergrund zu bringen. Die Transduktion mit P1-Phagen folgte einem zuvor veröffentlichten Protokoll, sofern nicht anders angegeben (Thomason et al, 2007). Um P1-Lysat herzustellen, E coli MG1655-Zellen mit Landeplätzen mit drei antibiotischen Markern (Kan, Cm und Tet) (YJP_MKC172) wurden über Nacht bei 37 °C in LB-Medien mit Antibiotika kultiviert. Am nächsten Tag wurden die Zellen 100-fach in 5 ml LB verdünnt, ergänzt mit 0,2% Glucose und 5 mM Calciumchlorid (CaCl&sub2;2) ohne Antibiotika. Nach 45 min Inkubation bei 37 °C, 250 U/min in einem New Brunswick Innova 44 Shaker (Eppendorf, USA), 100 μl P1-Phagenstamm geerntet aus E coli MG1655 wurde der Kultur zugesetzt und 3 h bei 37 °C inkubiert. Sobald die Kultur geklärt ist, werden einige Tropfen Chloroform (CHCl3) wurden hinzugefügt. Zelltrümmer wurden bei 9.200 ° C zentrifugiert g für 10 min bei 4°C unter Verwendung einer gekühlten Tischzentrifuge (Eppendorf, USA). Das resultierende P1-Lysat wurde durch einen 0,45-μm-Spritzenfilter (VWR International USA, 28145-481) weiter gereinigt. Um die P1-Transduktion durchzuführen, Wildtyp E coli MG1655 wurde in LB über Nacht bei 37 °C aus einer einzelnen Kolonie gezüchtet. Am nächsten Tag wurden 1,5 ml Übernachtkultur geerntet und in 0,75 ml P1-Salzlösung (10 mM CaCl&sub2;2 und 5 mM MgSO4) (Fisher Scientific, USA). Zu den 100 ul der resuspendierten Zellen wurden unterschiedliche Volumina an P1-Lysat (100, 10 und 1 ul) zugegeben und 30 min bei 25°C inkubiert. Die Mischungen wurden in 1 ml LB, ergänzt mit 200 µl Natriumcitrat, überführt und 1 h bei 37 °C und 250 Upm in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) inkubiert. Nach der Inkubation wurden die Zellen bei 21.000 . zentrifugiert g und 25°C für 30 s und wurden auf LB-Agar-(2%)-Platten mit Antibiotika und 5 mM Natriumcitrat ausplattiert. Kolonien wurden durch PCR-amplifizieren genomischer DNA mit Primern wie oben beschrieben (oYJP3436 und oYJP3437 für Landing Pad #1, oYJP3525 und oYJP3526 für Landing Pad #2 und oYJP2826 und oYJP2827 für Landing Pad #3) verifiziert. Nach der genomischen Insertion von Landepads enthielt jedes Landepad einen einzigartigen Antibiotikaresistenzmarker (Cm, Kan und Tet für Landing Pads #1, #2 bzw. #3). Diese Antibiotikaresistenzmarker befanden sich zwischen einem Paar von unidirektionalen Flippase-Erkennungszielstellen (FRT).

    RNA-seq

    RNA-seq-Bibliotheken wurden nach einem zuvor beschriebenen Verfahren hergestellt (Gorochowski et al, 2017 ). Escherichia coli MG1655-Stämme mit integrierten Landeplätzen (YJP_MKC173) wurden zunächst auf LB-Agar-(2%)-Platten ohne Antibiotika ausgestrichen und bei 37 °C inkubiert. Einzelne Kolonien wurden selektiert und über Nacht in M9-Medium ohne Antibiotika bei 37 °C gezüchtet. Am nächsten Tag wurden die Zellen in 200 &mgr;l M9-Medium ohne Antibiotika 185-fach verdünnt und 3 h bei 37 °C und 1000 Upm in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) gezüchtet. Nach 3 h wurden die Zellen 700-fach verdünnt, indem 4,28 &mgr;l der Kultur in 3 ml M9-Medium ohne Antibiotika zugegeben wurden.Zellen wurden unter Verwendung von Falcon 14 ml Polypropylenröhrchen mit rundem Boden (Corning, USA, 352059) in einem Innova 44 Shaker (Eppendorf, USA) bei 37 °C, 250 Upm gezüchtet. Nach 5 h wurden die Zellen bei 4°C und 21.000 . zentrifugiert g für 3 min, um die Zellpellets für die Vorbereitung der RNA-Seq-Bibliothek zu sammeln. Nach dem Verwerfen der Überstände wurden die Zellpellets in flüssigem Stickstoff zur Lagerung bei –80°C schockgefroren. Zellpellets wurden durch Zugabe von 1 mg Lysozym in 10 mM Tris-HCl (pH 8,0) mit 0,1 mM EDTA lysiert und die Gesamt-RNA wurde unter Verwendung des PureLink RNA Mini Kit (Life Technologies, CA, 12183020) extrahiert. RNA-Proben wurden mit dem RNA Clean & Concentrator-5 Kit (Zymo Research, R1015) weiter gereinigt und konzentriert, das von Bioanalyzer (Agilent, CA) verifiziert wurde. Ribosomale RNAs wurden aus RNA-Proben unter Verwendung des Ribo-Zero rRNA Removal Kit für Bakterien (Illumina, CA, MRZMB126) abgereichert. Für jede Probe wurden RNA-Integritätszahlen (RIN) erhalten, und nur die Proben mit RIN > 8,5 wurden für die Bibliotheksherstellung ausgewählt. Strangspezifische RNAtag-seq-Bibliotheken wurden vom Microbial Omics Core (MOC) der Broad Technology Labs erstellt, wo eindeutig mit Barcodes versehene Proben gepoolt wurden, um auf zwei separaten Spuren eines Illumina HiSeq 2500 zu laufen. Nach den Sequenzierungsläufen wurden die Reads aus beiden Spuren kombiniert , und die gepoolte Mischung wurde in Originalproben demultiplexiert, gefolgt vom Trimmen des Barcode-Tags von jedem Lesevorgang. Lysozym, Tris-HCl (pH 8,0) und EDTA, die für die Vorbereitung der RNA-Seq-Bibliothek verwendet wurden, wurden von Sigma-Aldrich (L6871), USB (75825) bzw. USB (15694) erworben. Rohe Sequenzierungs-Reads wurden mit den Referenzgenomen abgeglichen, und Transkriptionsprofile wurden nach einem zuvor entwickelten internen Python-Skript (Gorochowski et al, 2017). Kurz gesagt bestand der erste Schritt des Prozesses darin, neue Referenzdateien für das Genom von Stämmen mit integrierten Landeplätzen zu generieren. Daher wurden für jeden Stamm alle integrierten DNA-Sequenzen an ihren entsprechenden Stellen auf dem Referenzgenom von . eingefügt E coli MG1655 (NCBI RefSeq: NC_000913.3). Diese neuen FASTA- und GFF-Dateien wurden dann verwendet, um das Alignment von Raw-Reads unter Verwendung der BWA-Version 0.7.4 mit Standardeinstellungen durchzuführen, was zu entsprechenden SAM- und BAM-Dateien führte. Als nächstes wurden BAM-Dateien mit dem Befehl „view“ von SAMtools (Li et al, 2009 Barnett et al, 2011), und Filtercodes 83 und 163 wurden angewendet, um die Reads-Zuordnung auf den Sense-Strang auszuwählen, und Filtercodes 99 und 147 wurden angewendet, um die Reads-Mapping auf die Antisense-Stränge auszuwählen. Schließlich wurde die gefilterte Read Coverage an jeder Position entlang der Referenzsequenz durch die insgesamt kartierten Nukleotide über das Genom normalisiert und mit 10 9 multipliziert, um die Transkriptionsprofile sowohl in Vorwärts- als auch in Rückwärtsrichtung über das Genom zu erzeugen.

    Bewertung des Thiamin-abhängigen Wachstums

    Escherichia coli MG1655 und zwei Stämme, die Landing Pad #1 v1 und v2 beherbergen, wurden über Nacht in M9-Medium (mit Thiamin) gezüchtet. Am nächsten Tag wurden alle drei Kulturen zentrifugiert (15.000 g, 25°C, 3 min) und dreimal in DI-Wasser resuspendiert, um restliches Thiamin in den Medien zu entfernen. Die OD600 der resuspendierten Zellen wurde gemessen und die Zellen wurden auf OD . verdünnt600 = 0,01. Jede Verdünnung wurde dann in thiaminfreies M9-Medium, bestehend aus M9-Minimalsalz (Sigma-Aldrich, USA, M6030), ergänzt mit 0,4% Glucose und 0,2% Casaminosäuren (BD Biosciences, USA, 223050), angeimpft. Nach 6 h Inkubation bei 37 °C und 250 U/min in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) wurde die OD600 von drei Proben und einer Leerprobe, die nur thiaminfreies M9-Medium enthielt, wurden mit einem Cary 50 Bio Spectrophotometer (Agilent, USA) gemessen.

    Einbringen von Nutzlasten in Landeplätze

    Beachten Sie, dass ein leicht verständliches detailliertes Protokoll als Anhang Anmerkung S1 bereitgestellt wird. Der die leeren Landeplätze enthaltende Stamm wurde mit einem Plasmid, das für drei Integrasen kodiert (plYJP053) und einem Plasmid, das die DNA-Nutzlasten enthält (plYJP066-KanR, plYJP070-CmR und plYJP064-TetR) co-transformiert. Um elektrokompetente Zellen herzustellen, wurde eine einzelne Kolonie in 2 ml LB ohne Antibiotika inokuliert und 12 h bei 37 °C und 250 U/min in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) unter Verwendung von Falcon 14-ml-Rundboden-Polypropylenröhrchen gezüchtet (Corning, USA, 352059). Am nächsten Tag wurden 125 µl der Übernachtkultur zu 25 ml SOB-Medium in einem Erlenmeyerkolben mit Spitzboden zugegeben. Die Zellen wurden 2 h bei 37 °C und 250 Upm in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) gezüchtet. Wenn die frühe exponentielle Phase erreicht wurde (OD600 = 0,3–0,5), Zellen wurden zentrifugiert (4.700 g, 4°C, 10 min) und dreimal mit gekühltem 10% Glycerin gewaschen. Nach dem dritten Waschen wurden die Zellen mit 200 &mgr;l gekühltem 10% Glycerin resuspendiert. Zellen wurden mit 500 ng pYJP053-Plasmid und 500 ng der Nutzlastplasmide elektroporiert. Unmittelbar nach der Transformation wurde den Zellen 1 ml SOC-Wiedergewinnungsmedium zugesetzt. Die Zellen wurden dann 3 h bei 30°C inkubiert und mit den notwendigen Antibiotika auf LB-Agarplatten (2 %) ausplattiert. Das Einsetzen in die Landing Pads #1, #2 und #3 wurde mit Kan (50 µg/ml), Cm (35 µg/ml) bzw. Tet (5 µg/ml) ausgewählt. Um die Integration mit Kolonie-PCR zu bestätigen, wurden Primer verwendet, die die Verbindung zwischen integrierten Konstrukten und der angrenzenden genomischen DNA amplifizieren können. Für die Landing Pads #1 und #2 wurde oYJP2164 (AATAAACAAATAGGCATGGTCTAAGAAACCATT) als Primer verwendet, der an das integrierte Konstrukt bindet. oYJP3436 (CCTGATCAGGTTCCGCGGATCCCGAATAAACGGTC) und oYJP3526 (TGCCAAAGGCGATAGGTGAAATAATGTCGGCGACAGCGG) wurden als Primer verwendet, die genomische DNA angrenzend an Landing Pad #1 bzw. Landing Pad #2 binden. Für Landing Pad #3 wurde ein Vorwärtsprimer, der in Vorwärtsrichtung an das Ende des integrierten Konstrukts bindet, mit Primer oYJP2826 (AGAGATGACAGAAAAATTTTCATTCTGTGACAGAGAAAAAGTAGCCGAAGATG) verwendet, um die Verbindung zwischen Landing Pad #3 und der angrenzenden genomischen DNA zu amplifizieren. Die Amplikongröße wurde mittels Gelelektrophorese bestätigt. Alle drei Marker können entfernt werden, indem Stämme, die die Landeplätze mit inserierten Nutzlasten beherbergen, mit dem pE-FLP-Plasmid transformiert werden, das einen temperaturempfindlichen Replikationsursprung (St-Pierre .) enthält et al, 2013). Dazu wurde jeder Stamm über Nacht in 2 ml LB-Medium mit entsprechenden Antibiotika (Cm (35 µg/ml), Kan (50 µg/ml) und Tet (5 µg/ml)) bei 37 °C und 250 °C kultiviert UpM in einem New Brunswick Innova 44 Shaker (Eppendorf, USA) unter Verwendung von Falcon 14 ml Rundboden-Polypropylenröhrchen (Corning, USA, 352059). Am nächsten Tag wurden die Zellen 200-fach in 4 ml LB-Medium ohne Antibiotika verdünnt und bei 37 °C und 250 U/min in einem New Brunswick Innova 44 Shaker unter Verwendung von Falcon 14-ml-Polypropylenröhrchen mit rundem Boden (Corning, USA, 352059 .) inkubiert ) für 2 h bis zum Erreichen von OD600 = 0,4. Die Zellen wurden dann durch Zentrifugation geerntet (4.700 g, 4 °C, 10 min) unter Verwendung einer Legend XFR-Zentrifuge. Die Zellpellets wurden mit 1 ml gekühltem 10 % Glycerin gewaschen und unter Verwendung einer gekühlten Tischzentrifuge (Eppendorf, USA) bei 21.000 °C zentrifugiert g und 4°C für 30 s für dreimal. Schließlich wurden Zellpellets in 75 µl gekühltem 10 % Glycerin resuspendiert, wodurch elektrokompetente Zellen erhalten wurden, die dann mit 20 ng pE-FLP (St-Pierre et al, 2013 ), gefolgt von Rückgewinnung in 1 ml SOC-Medium und Inkubation bei 30 °C für 30 Minuten. Die Zellen wurden dann auf LB-Agarplatten (2%) mit Amp (100 &mgr;g/ml) ausplattiert und über Nacht bei 30 °C inkubiert. Am nächsten Tag wurden drei einzelne Kolonien auf LB-Agarplatten (2%) ohne Antibiotika ausgestrichen und über Nacht bei 37 °C inkubiert. Drei Kolonien aus jedem Streak wurden dann in LB-Medien mit vier Antibiotika (Amp (100 µg/ml), Cm (35 µg/ml), Kan (50 µg/ml) und Tet (5 µg/ml)) bei 37 °C gezüchtet °C und 1.000 U/min für 16 h auf einem ELMI-Plattenschüttler unter Verwendung von Nunc™ 96-Well-Platten (Thermo Scientific, USA, 249662). Zellen, die nicht in allen vier Antibiotika wuchsen, wurden ausgestrichen und dann als Endstämme verwendet.

    Berechnung von RPU (relative Promotoreinheiten)

    Escherichia coli MG1655 mit der RPUg Referenzpromotor (YJP_MKC254) wurde auf einer LB-Agarplatte ohne Antibiotika ausgestrichen und über Nacht bei 37 °C inkubiert. Von der Platte entnommene Einzelkolonien wurden dann in 200 &mgr;l M9-Medium ohne Antibiotika inokuliert und über Nacht inkubiert. Alle Kultivierungsschritte wurden bei 37 °C und 1000 Upm in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) durchgeführt. Am nächsten Tag wurden die Zellen in 200 µl M9-Medium ohne Antibiotika 185-fach verdünnt und 3 h inkubiert. Anschließend wurden die Zellen wieder 700-fach in 200 µl M9-Medium ohne Antibiotika verdünnt und 5 h inkubiert. Anschließend wurde ein 30 µl Aliquot in 200 µl 1x PBS-Lösung mit 2 mg/ml Kanamycin überführt und mittels Durchflusszytometrie ausgewertet. Um die Fluoreszenz eines Promotors von au (<YFP>gemessen) zu RPUg, wird die folgende Gleichung verwendet: [(<YFP>gemessen)-(<YFP>leer)]/[(<YFP>RPU)-(<YFP>leer)], wobei <YFP>leer ist Autofluoreszenz von Wildtyp E coli MG1655.

    RPUg-zu-RNAP-Flusskonvertierung

    RPUg wurde in RNAP-Flux umgerechnet durch Multiplikation eines zuvor berechneten Umrechnungsfaktors 1 RPU = 0,019 RNAP/s pro DNA (B. Shao, J. Rammohan, DA Anderson, N. Alperovich, D. Ross & CA Voigt, unveröffentlichte Daten) und der Kopie DNA-Nummer, auf der sich Landing Pad #1 befindet. Die Kopienzahl des Landing Pad #1 wurde auf 3,5 geschätzt, indem die Tn5-Expressionsdaten für Stelle 7, an der sich Landing Pad #1 befindet, und die Stelle #3, eine Stelle neben der Einzelkopie-Region des Genoms, verglichen wurden. Beachten Sie, dass für RPU und RPU . derselbe Promotor verwendet wirdg Standardkassette, und es wird angenommen, dass dieser Promotor an beiden Stellen den gleichen konstitutiven Fluss erzeugt. Daher 1 RPUg wurde in 0,067 RNAP/s umgewandelt.

    Sensorcharakterisierung

    Der Stamm, der die sieben Sensoren in Landing Pad #3 (YJP_MKC174) enthält, wurde mit einem Reporterplasmid transformiert, das einen an . fusionierten Promotor enthält yfp (plYJP067-(Promotorname)), das auf die sieben Regulatoren (AraC, LacI, TetR, CymR AM, VanR AM, CinR AM und TtgR AM) anspricht und auf LB-Agar-Platten (2%) mit Kan (50 μg .) ausgestrichen wurde /ml). Einzelne Kolonien wurden in 200 ul M9-Medium mit Kan (50 ug/ml) geimpft und über Nacht bei 37 °C und 1.000 UpM in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten gezüchtet. Am nächsten Tag wurden die Zellen 185-fach in 200 µl frischem M9-Medium ohne jegliche Antibiotika verdünnt und drei Stunden bei 37 °C und 1.000 U/min in einem ELMI-Plattenschüttler unter Verwendung von Nunc™ 96-Well-Platten (Thermo Scientific, USA, 249662). Die Zellen wurden dann 700-fach in 200 μl frischem M9-Medium (keine Antibiotika) mit geeigneten Induktoren verdünnt und für 5,5 Stunden in einem ELMI-Plattenschüttler bei 37 °C und 1.000 U/min unter Verwendung von Nunc™ 96-Well-Platten (Thermo Scientific, USA) inkubiert , 249662). Dann entweder 12,5 mM L-Arabinose (Sigma-Aldrich, USA, A3256), 1 mM IPTG (GoldBio, USA, I2481C), 20 ng/μl aTc (Sigma-Aldrich, USA, 37919), 500 μM 4-Isopropylbenzoesäure (Sigma-Aldrich, USA, 268402), 200 μM Vanillinsäure (Sigma-Aldrich, USA, H36001), 10 μM OHC14 (Sigma-Aldrich, USA, 51481) oder 1 mM Naringenin (Sigma-Aldrich, USA, N5893) wurde verwendet, um die Sensoren zu induzieren. Nach 5,5 h wurden 30 µl Zellen zu 200 µl 1 x PBS mit 2 mg/ml Kan für die durchflußzytometrische Analyse gegeben.

    NOT/NOR-Gatter-Charakterisierung

    Jeder Stamm, der ein NOT-Gate enthielt, wurde auf den LB-Agar-(2%)-Platten mit Kan (50 µg/ml) und Cm (35 µg/ml) Antibiotika ausgestrichen. Eine einzelne Kolonie wurde gepickt und in M9-Medium mit Kan (50 &mgr;g/ml) und Cm (35 &mgr;g/ml) für eine Kultur über Nacht in einem ELMI-Plattenschüttler bei 37 °C und 1000 Upm inokuliert. Zellkulturen wurden unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) durchgeführt. Am nächsten Tag wurden die Zellen in 200 &mgr;l frischem M9-Medium ohne Antibiotika 185-fach verdünnt und für 3 h in einem ELMI-Plattenschüttler bei 37 °C und 1.000 U/min inkubiert. Nach den 3 h wurden die Zellen dann wieder 700-fach in 200 &mgr;l frischem M9-Medium ohne Antibiotika verdünnt und mit Induktoren für weitere 5,5 h in einem ELMI-Plattenschüttler bei 37 °C und 1000 Upm inkubiert. Nach den 5,5 h wurden 30 µl Zellen zu 200 µl 1 x PBS mit 2 mg/ml Kan für die durchflußzytometrische Analyse gegeben. Um die OD zu messen, wurden 150 ul Aliquots auf eine optisch transparente Nunc™ 96-Well-Platte (Thermo Scientific, USA, 165305) übertragen, um die OD . zu messen600 unter Verwendung eines Hybrid-Mikroplatten-Readers BioTek Synergy H1 (BioTek Instruments Inc, USA). Um die Gate-Response-Funktionen zu messen, wurden Input- und Output-Promotor-Aktivitäten, gemessen als mediane YFP-Fluoreszenz, in RPU . umgewandeltg. Die Antwortfunktionen wurden an eine Hill-Gleichung angepasst ja = jaMindest + ((jamax − jaMindest)/(1 + (x/K) n ), indem ein internes Python-Skript verwendet wird.

    Automatisierung des Schaltungsdesigns mit Cello 2.0

    Die Cello 2.0-Software (cellocad.org) und der Code sind Open Source auf GitHub (github.com/CIDARLAB/Cello-v2) verfügbar. Beachten Sie, dass die UCF in diesem Dokument für Cello 2.0 entwickelt wurde und nicht mit der alten webbasierten Cello-Schnittstelle ausgeführt werden kann. Eine UCF-Datei (Eco2C1G3T1.UCF.json) (Anhang Datei S1) wurde erstellt, um Hill-Parameter für NOT-Gate-Antwortfunktionen in der Gate-Bibliothek (Tabelle 1), Zytometrieverteilungen jedes Gates, Eugene-Regeln, Landeplatzinformationen und Wachstumstestbedingungen. Sensor-Output-Promoter-Aktivitäten (PBadmc, JaMindest = 0,04, Ymax = 3,33 PTac, JaMindest = 0,02, Ymax = 4,20 PTet, JaMindest = 0,02, Ymax = 5,41 PCymRC, JaMindest = 0,19, Ymax = 2,39 PVanCC, JaMindest = 0,02, Ymax = 3,79 PCin, JaMindest = 0,01, Ymax = 4,38 und PTtgR, JaMindest = 0,01, Ymax = 0,22 (in RPUg)), eine UCF-Datei, eine als Verilog-Datei formulierte Wahrheitstabelle und der Wachstumswert-Cutoff (eingestellt auf 0,75) wurden für jedes Schaltungsdesign verwendet. Cello 2.0 wurde lokal mit der Cello 2.0 API ausgeführt.

    Aufbau des genetischen Schaltkreises

    Genetische Schaltkreise wurden zuerst gespalten und in zwei Plasmide kloniert, plYJP066 (KanR) und plYJP070 (CmR), die auf Landing Pads #1 bzw. #2 abzielen, unter Verwendung von Typ-II-Assembly, wie zuvor beschrieben (Nielsen et al, 2016 Shin et al, 2020). Die Reihenfolge der Transkriptionseinheiten innerhalb eines Zirkels wurde von Cello 2.0 nach den EUGENE-Regeln vergeben. Kurz gesagt, jede Transkriptionseinheit des Kreislaufs wurde in plYJP080 (AmpR) (Anhang Abb. S14 und Anhang Tabelle S6) mit p15a-Ursprung subkloniert, wobei Typ II-Assemblierung mit BsaI (New England Biolabs, USA, R3733) und T4-Ligase HC . verwendet wurde (Promega, USA, M1794). Die Reaktionsmischung wurde durch Zugabe von 40 fmol jedes DNA-Fragments, 1 µl BsaI, 0,5 µl T4-Ligase HC, 1,5 µl T4-Ligasepuffer (Promega, USA, M1794) und Wasser bis zu 15 µl hergestellt. Die Reaktionsmischung wurde dann 30 Mal zwischen 37 °C (5 min) und 16 °C (3 min) zyklisiert, was zu Transkriptionseinheiten (in plYJP080-Plasmiden) führte, die bereit sind, in der genetischen Schaltungskonstruktion verwendet zu werden. Für jeden entworfenen genetischen Schaltkreis wurden alle verwendeten Transkriptionseinheiten unter Verwendung von BbsI (New England Biolabs, USA, R3539) und T4-Ligase HC (Promega, USA, M1794) zu einem vollständigen Schaltkreis zusammengesetzt. Die Reaktionsmischung umfasste 40 fmol jedes plYJP080-Plasmids, das die Transkriptionseinheit enthielt, 1 μl BbsI, 0,5 μl T4-Ligase-HC, 1,5 μl T4-Ligasepuffer (Promega, USA, M1794) und Wasser bis zu 15 μl. Die Reaktionsmischung wurde dann 50 Mal zwischen 37 °C (5 min) und 16 °C (3 min) für die Zusammenbaureaktion zyklisiert, was zu zwei neuen Plasmidrückgraten plYJP066 und plYJP070-Plasmiden führte. Diese beiden Plasmide wurden dann wie oben beschrieben in das Genom integriert. Antibiotikamarker wurden durch Transformieren von pE-FLP (St-Pierre et al, 2013). Das pE-FLP-Plasmid wurde durch Inkubieren von Zellen bei 37 °C wie zuvor beschrieben (Anhang Fig. S14) gehärtet.

    Charakterisierung des genetischen Schaltkreises

    Stämme, die einen genetischen Schaltkreis beherbergen, wurden auf der LB-Agar-(2%)-Platte ohne Antibiotika ausgestrichen. E coli MG1655 Wildtyp und RPUg Standardstämme wurden als Kontrollen ausgestrichen. Einzelne Kolonien wurden von Platten gepickt und in M9-Medien ohne Antibiotika geimpft. Die Zellen wurden über Nacht bei 37 °C und 1000 Upm in einem ELMI-Plattenschüttler unter Verwendung von Nunc TM 96-Well-Platten (Thermo Scientific, USA, 249662) inkubiert. Am nächsten Tag wurden die Zellen dann 185-fach in 200 μl frischem M9-Medium ohne Antibiotika verdünnt und für drei Stunden bei 37 °C, 1.000 U/min in einem ELMI-Plattenschüttler unter Verwendung von Nunc™ 96-Well-Platten (Thermo Scientific, USA, 249662). Nach drei Stunden wurden die Zellen 700-fach in M9-Medium ohne Antibiotika verdünnt und mit geeigneten Kombinationen von Induktoren wie 1 mM IPTG, 12,5 mM L-Arabinose, 20 ng/μl aTc, 10 μM OHC14 und 200 μM Vanillinsäure induziert wurden wie in der Cello 2.0-Vorhersage angegeben verwendet. Nach 5,5 h wurden 30 µl Zellen zu 200 µl 1 x PBS mit 2 mg/ml Kan für die durchflußzytometrische Analyse gegeben. Die mittlere YFP-Fluoreszenz jeder Probe wurde mit der Software FlowJo (TreeStar, Inc., USA) analysiert und in RPU . umgewandeltg.

    Berechnung des gesamten RNAP-Flusses

    Die Input-Promotor-Aktivität (RNAP-Fluss) jedes NOT- und NOR-Gatters in der 0xF1-Schaltung wurde für jeden Zustand unter Verwendung des Cello 2.0-Softwarepakets berechnet. Der gesamte RNAP-Fluss für einen Kreislauf wurde durch Summieren der Promotoraktivitäten über alle Gates im Kreislauf, einschließlich der Ausgangspromotoren der Sensoren, berechnet. Für die genomkodierte 0xF1-Schaltung haben wir die UCF-Datei Eco2C1G3T1, die Wahrheitstabelle (0xF1.v) und die genomkodierten Sensor-Output-Promotor-Aktivitäten (oben beschrieben) verwendet. Der UCF basierte auf einem gewöhnlichen additiven Modell für die Tandem-Promotoraktivität und wurde nicht mit Tandem-Roadblocking-Regeln kodiert. Für die Plasmid-kodierte 0xF1-Schaltung verwendeten wir die UCF-Datei Eco1C2G2T2, die Wahrheitstabelle (0xF1.v) und die Plasmid-kodierten Sensor-Output-Promotoraktivitäten (Plux2, JaMindest = 0,030, Ymax = 2,234 PTac, JaMindest = 0,018, Ymax = 1,689 PTet, JaMindest = 0,040, Ymax = 1,967 und PCin, JaMindest = 0,005, Ymax = 3,178 (in RPU)). Die UCF wurde mit einem nicht-additiven Tandem-Promotor-Modell kodiert. Sobald die Schaltungen entworfen wurden, wurden die Design-Ausgabedateien (0xF1_A000_logic_circuit.txt (Genom), 0xF1_A001_logic_circuit.txt (Plasmid)) verwendet, um den gesamten RNAP-Fluss zu berechnen, der von der Schaltung verwendet wird.Aus jeder Datei wurde die Eingabe-Promotor-Aktivität jedes NOT- und NOR-Gatters in der Schaltung (zweite bis letzte Spalte) summiert, um den gesamten RNAP-Fluss zu berechnen. Der berechnete Gesamt-RNAP-Fluss für genomkodierte Schaltkreise (in RPUg) wurde dann durch 6,33 geteilt (Anhang Abb. S4), um die RPU umzurechneng in RPU. Der gesamte RNAP-Fluss für einen Plasmid-kodierten Schaltkreis wurde in RPU berechnet.

    Langzeitstabilitätstest

    Der Plasmid-kodierte 0xF1-Schaltkreis wurde unter Verwendung des UCF für das p15a-Plasmid (Eco1C2G2T2) entworfen und in konstruiert E coli DH10β (Nielsen et al, 2016 Shin et al, 2020). Die E coli Der MG1655-Stamm, der den genomkodierten 0xF1-Kreislauf beherbergte, wurde auf LB-Agar-(2%)-Platten mit Kan (50 &mgr;g/ml) und Cm (35 &mgr;g/ml) Antibiotika ausgestrichen und über Nacht gezüchtet. Die E coli Der DH10β-Stamm, der den Plasmid-kodierten 0xF1-Kreislauf beherbergte, wurde auf LB-Agar-(2%)-Platten, die Kan (50 &mgr;g/ml) enthielten, ausgestrichen und über Nacht wachsen gelassen. Für jede wurden drei Kolonien gepickt und in M9-Medien ohne Antibiotika gezüchtet. Jeden Tag wurde jede Kultur 10 4 -fach in 500 μl frischem M9-Medium in 96-Deep-Well-Platten (USA Scientific, USA, 1.896–2.000) mit der in Abb. 5 angegebenen Induktorkombination verdünnt. Nach 8 h Inkubation bei 37 °C °C und 900 rpm in einem Multitron Pro Incubator Shaker (In Vitro Technologies, VIC, Australien) wurden 30 µl Zellen zu 200 µl 1× PBS mit 2 mg/ml Kan für die durchflusszytometrische Analyse gegeben und 100 µl Zellen wurden gemischt mit 80% autoklaviertem Glycerin (VWR-Chemikalie BDH1172-1LP) und bei –80°C gelagert. Ein weiteres Aliquot wurde mit denselben Induktorkombinationen 100-fach in frischem Medium verdünnt und über Nacht inkubiert. Der Zyklus wurde 12 Tage lang fortgesetzt, indem dieses Protokoll wiederholt wurde. Um die OD . zu messen600 von Genom- und Plasmid-kodierten Schaltkreisen wurden einzelne Kolonien aus dem Streak in M9-Medium inokuliert und über Nacht bei 37 °C und 1.000 U/min in einem ELMI-Plattenschüttler inkubiert. Zellen, die Plasmid-kodierte genetische Schaltkreise beherbergen, wurden über Nacht mit Kan (50 µg/ml) inkubiert. Genom-kodierte Schaltkreise wurden über Nacht ohne Antibiotika inkubiert. Am nächsten Tag wurde jede Kultur 185-fach in 3 ml frischem M9-Medium verdünnt und 3 h bei 37 °C und 250 Upm in einem Innova-Schüttler wachsen gelassen. Drei Stunden später ist die OD600 jeder Kultur (OD600) wurde mit einem Cary 50 Bio Spectrophotometer (Agilent, USA) gemessen. Die gemessene OD600 wurde verwendet, um die Probenmenge zu berechnen, die erforderlich ist, um die gleiche Anzahl von Zellen in die zweite Verdünnung zu übertragen. Zellen wurden verdünnt

    700-fach in 3 ml M9-Medium mit geeigneten Induktoren und wurden 5,5 h bei 37 °C und 250 U/min in einem Innova-Schüttler wachsen gelassen. Das Wachstum von Zellen ohne Kreislauf wurde entweder mit E coli MG1655 mit leeren Landeplätzen (YJP_MKC173) oder E coli DH10β, das ein p15a-Plasmid mit einem Kan (50 &mgr;g/ml)-Resistenzgen (pYJP018) enthält.


    Bakterien

    Binär Fission ist die Aufspaltung einer Mutterzelle in zwei Tochterzellen es ist die ungeschlechtliche Fortpflanzung in Prokaryonten.

    Bei Bakterien kann die genetische Rekombination auf drei Arten erfolgen.

    1. Konjugation

    2. Transformation

    3. Transduktion

    III. Prokaryontische Ernährung

    Autotroph ( Chemotroph oder Photosynthese ) / Heterotroph

    Mutualisten (symbiotischer) Stickstoff‑fixing Rhizobium Bakterien / Darmbakterien beim Menschen

    NS. BAKTERIEN-KLASSIFIZIERUNG

    1. Drei Grundformen: Kokkus / Bazillus / Spirillum

    2. Diese Formen können organisiert werden in

    Staphylokokken = Cluster / Streptokokken = Ketten

    A. Bacillus B. Streptococcus C. Staphylococcus D. Diplococcus E. Spirllum F. Vibrio

    3. Grammflecken

    Wird verwendet, um Bakterien zu identifizieren / grampositiv = dunkelviolett / gramnegativ = rosa


    Charakterisierung von rekombinantem E coli ausdrücken arsR von Rhodopseudomonas palustris CGA009, das eine hochselektive Arsenadsorption zeigt

    Gesucht werden innovative Methoden zur Verringerung der Arsen (As)-Exposition. Es wird berichtet, dass das As-regulatorische Protein (ArsR) eine hohe Affinität und Spezifität für Arsenit [As(III)] aufweist. Rhodopseudomonas palustris CGA009 ist ein guter Modellorganismus zum Studium Als Entgiftung aufgrund von mindestens drei ars Operons und vier verschiedene arsRRP1–4 auf dem Genom. In dieser Studie wurden vier Escherichia coli beherbergen arsRRP1–4 abgeleitet von CGA009 wurden konstruiert und hinsichtlich ihrer As-Beständigkeit getestet. Die Ergebnisse haben gezeigt, dass E coli (arsRRP2) zeigte eine robuste As(III)-Resistenz und seine Wachstumshemmungsrate betrug nur 2,9%, wenn es 3,0 mmol/l As(III) ausgesetzt wurde. Bei pH 7,0, E coli (arsRRP2) zeigte eine erhöhte As-Adsorptionskapazität. As(III) (2,32 mg/g (Trockengewicht, dw)) und 1,47 mg/g Arsenat [As(V)] wurden adsorbiert, was einer 4,2- bzw. 1,3-fachen Zunahme im Vergleich zum Kontrollstamm entspricht. Der Adsorptionsprozess war gut an den isothermen Modus von Langmuir angepasst. E coli (arsRRP2) (1.0

    82,2% As (III) bei Exposition gegenüber 10 µg/L As(III). Es konnte keine Zunahme der Aufnahme an Kupfer(II), Zink(II), Chrom(III) und Blei(II) festgestellt werden. Unsere Studien haben ergeben, dass arsRRP1–4 von CGA009 könnte As(III)-Resistenz verleihen E coli (arsRRP2) zeigte die höchste As-Beständigkeit, Selektivität und Adsorptionskapazität innerhalb eines breiteren pH-Bereichs (5,0

    15,0 g/l NaCl) Bereich, besonders wichtig, da er As(III) aus niedrig konzentriertem As-haltigem Wasser entfernen kann.


    Schlussfolgerungen

    Untersuchung der physiologischen und metabolischen Reaktionen eines angepassten E coli Kultur-zu-Substrat-Störungen, hebt Parameter hervor, die für das metabolische Engineering und das Prozessdesign in Bezug auf den Großreaktorbetrieb zu berücksichtigen sind.

    Zellen reagierten sofort auf einen Überschuss an Substrat, indem sie ihre Aufnahmerate und folglich die intrazellulären Flüsse innerhalb von zehn Sekunden erhöhten. Kohlenstoff wurde in intrazellulären Zwischenprodukten, während der Substratmahlzeit gespeichert und während einer Hungerphase verbraucht.

    Trotz der stark wechselnden Dynamik wurde die Energieladungshomöostase als bemerkenswertes Fitnessmerkmal der Reaktion auf Störungen beobachtet, was auf eine schnelle Stoffwechselregulation hinweist.

    Wichtiger und höchst relevant für industrielle Fermentationen war die 30%ige Abnahme der Biomasseausbeute, die während der intermittierenden Fütterung im Vergleich zu einem Referenz-Steady-State auftritt. Das Verschütten von Energie war daher ein Kompromiss für die Anpassung des Mikroorganismus an die dynamische Umgebung, um ein robustes Wachstum zu erzielen.

    Die erhaltenen Ergebnisse zeigten einige Gründe für die reduzierte Leistung von Zellfabriken beim Scale-up auf. E coli reagiert auf Stress, der durch Substratgradienten induziert wird, indem er eine spezifische Stoffwechselstrategie startet. Um die Produktivität in großtechnischen Bioprozessen kosteneffektiv zu verbessern, müssen wir die Mechanismen hinter der Stressanpassung, Einschränkungen bei der Substrataufnahme und Atmung, potenzielle Energieabgabewege und optimale Wachstumsziele der Zellen weiter identifizieren, indem wir Multi-Omics-Ansätze kombinieren .


    Schau das Video: Escherichia coli Enteroagregativa. Nutrición clínica (Oktober 2022).