Information

Primer-Design für Gibson-Montage

Primer-Design für Gibson-Montage


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich versuche, eine Grundierung für die Gibson-Montage zu entwerfen. Mein interessierendes Gen befindet sich auf einem Plasmid, und ich möchte dieses Gen kopieren und in ein anderes Plasmid einfügen.

Ich bin mir nicht sicher, wie ich meine Primer für die PCR entwickeln soll. Ich weiß, dass ich 2 Primer-Sets (4 insgesamt) benötige.

  1. Rückwärts- und Vorwärtsprimer, um mein Gen aus dem Plasmid zu kopieren, das es enthält.
  2. Rückwärts- und Vorwärtsprimer, um das Plasmid zu kopieren.

Ich weiß auch, dass ich komplementäre Überlappungsbereiche zwischen meinem Gen und dem Plasmid schaffen muss, in das ich es einfügen möchte. Wie mache ich das?

Hier ist das Plasmid und das Gen. Ich möchte das Gen zwischen dem Biobrick-Präfix und -Suffix platzieren.

Hier sind die Primer, die ich denke, dass ich sie brauche:

Für das Plasmid, in das ich das Gen einfügen möchte, sollten meine Primer sein

  • Nach vorne:ATTCGCGGCCGCTTCTAGAG
  • Umkehren:CTGACGCGGCCGCTACTAGTA

Primer zum Kopieren von Genen und Hinzufügen von Überlappungen

  • Umkehren:ATCATTTCAAATTCGTCCATCTCTAGAAGCGGCCGCGAAT
  • Nach vorne:AATTAGAAAGAGATTATAATACTAGTAGCGGGCCGCTGCA

Hier ist das Gen

Hier ist das Plasmid, in das ich es einfügen möchte. Ich verwende geneious, aber ich denke, für diesen Zweck funktioniert Word gut.


Haftungsausschluss: Ich habe noch nie eine Gibson-Montage gemacht, aber hier ist mein theoretisches Verständnis, wie Sie Ihre Primer entwerfen. Sie benötigen vier 40mere, die jeweils aus 20 bp-Segmenten bestehen, die vom Vektor und dem Insert abgeleitet sind und den Verbindungen entsprechen, die Sie erstellen möchten. Im Diagramm unten repräsentieren die gestrichelten Linien die Verbindungen zwischen den beiden 20 bp-Segmenten jedes 40mers.


Hier ist ein guter Überblick über die Überlegungen zum Primer-Design bei der Verwendung der Gibson-Montage. http://j5.jbei.org/j5manual/pages/22.html


Primer-Design für Gibson-Montage - Biologie

Das Tool entwirft Primer mit einer Länge von 60 Nukleotiden (nt). Jeder Primer enthält 20 nt genspezifische Sequenz für das Template-Annealing und 30-40 nt Überlappungssequenz, die verwendet wird, um eine homologe Überlappung zwischen zwei benachbarten Fragmenten zu erzeugen.

40bp homologe Sequenzen

Das Gibson Assembly® Primer Design Tool generiert Primer, die zum Hinzufügen homologer Überlappungen zu Fragmenten verwendet werden, um eine effiziente Montage zu ermöglichen. Primer sind mit einer Länge von 60 Nukleotiden fixiert und umfassen 20 Nukleotide einer genspezifischen Sequenz für das Template-Annealing. Zwischen dem Vektor und der Insertionsstelle kann ein Sequenzmotiv von bis zu 10 nt Länge eingebaut werden, um einen Restriktionsverdau zu ermöglichen. Als Ergebnis können nach der PCR-Amplifikation 30 bis 40 bp homologe Überlappung erzeugt werden. Die Überlappungsgröße ist ausreichend, um eine Fragmentanordnung von bis zu 10 kb oder bis zu 15 Fragmente mit Inserts von jeweils bis zu 1 kb zu unterstützen. Für den Zusammenbau großer Gene wird eine Verlängerung der homologen Überlappung empfohlen.


Übersicht über die Gibson-Montage

Die Gibson-Montagetechnik wurde erstmals 2009 von Dr. Daniel Gibson und Kollegen am J. Craig Venter Institute beschrieben. Hier bei Addgene haben wir diese Option 2014 aufgrund ihres Gewinns zu unserem Dropdown-Menü der üblichen Klonoptionen im Einzahlungsprozess hinzugefügt an Popularität. Die Gibson-Assemblierung ist dafür bekannt, dass sie die einfache Assemblierung mehrerer linearer DNA-Fragmente ermöglicht, kann aber auch für die grundlegende Klonierung eines Inserts in den Vektor Ihrer Wahl verwendet werden, wie in der Abbildung unten gezeigt. Um zu beginnen, benötigen Sie DNA-Fragmente mit Homologieregionen an ihren Enden, die typischerweise durch PCR erzeugt werden. Anschließend werden die Fragmente zusammen mit einem Enzym-Mastermix inkubiert, der drei verschiedene Enzyme enthält:

  • eine Exonuklease, die die 5'-Enden des Fragments zurückkaut und lange Überhänge erzeugt, die es den einzelsträngigen Regionen mit Homologie ermöglichen, sich zu verbinden
  • eine Polymerase, um die Lücken zu füllen
  • eine DNA-Ligase, um die Kerben der angelagerten und ausgefüllten Lücken zu versiegeln

Das Tolle an dieser Mischung von Enzymen ist, dass sie alle bei der gleichen Temperatur arbeiten können, sodass die gesamte Reaktion bei 50 °C eine Stunde oder weniger dauert. Nach etwa einer Stunde ist die Probe sofort bereit, sich in kompetente Zellen umzuwandeln. Der Mastermix der Enzyme kann von einer Firma bezogen werden (z. B. NEB oder SGI-DNA) oder kann selbst gemischt werden (z. B. siehe Miller Lab Protocol). Der Gibson-Assembly-Prozess kann verwendet werden, um bis zu 6 Fragmente in einem Schritt zusammenzusetzen, was zu einer narbenfreien Assemblierung führt, die weder das Vorhandensein (oder Fehlen derselben) spezifischer Restriktionsschnittstellen noch einen ernsthaften Zeitaufwand erfordert. Ein weiterer Vorteil besteht darin, dass dieses Verfahren es einfach macht, Wildtyp- und Mutantenkonstrukte gleichzeitig und nicht nacheinander zu erzeugen.


Gibson Assembly ist ein beliebter Weg, um Fragmente in ein Plasmid einzufügen, ohne Restriktionsenzyme zu verwenden. Um diese Methode zu simulieren, bietet SnapGene eine intuitive Benutzeroberfläche.

Für die Gibson-Assembly amplifizieren PCR die DNA-Segmente, um überlappende Enden zu erzeugen. Inkubieren Sie dann die amplifizierten Produkte mit Assemblierungsenzymen und wandeln Sie die Mischung in Bakterien um.

SnapGene vereinfacht die Gibson-Montage durch die Automatisierung des Primer-Designs. Um eine Gibson-Assembly-Reaktion zu planen, wählen Sie einfach die DNA-Fragmente aus, die Sie verbinden möchten, und SnapGene wählt geeignete Primer aus.

Diese Seiten bieten weitere Informationen über Gibson Assembly:

„SnapGene hat uns sehr bei der Planung unserer Gibson-Assemblys und Restriktionsklonierungsschritte sowie beim Design unserer preisgekrönten Promoter-Kollektion geholfen. Ich glaube, es gab keinen Tag, an dem wir die Software nicht benutzt haben.“


Klonen mit dem Gibson Assembly Wizard

Um auf den Montageassistenten zuzugreifen, öffnen Sie zunächst eine Sequenzdatei. Am unteren Bildschirmrand finden Sie den Montageassistenten neben Arbeitsbereich teilen. Klicken Sie auf Baugruppenassistent und wählen Sie dann Neue Baugruppe erstellen. Wählen Sie in den angebotenen Optionen Gibson aus und drücken Sie Start, um mit der Montage fortzufahren.

Öffnen Sie eine Backbone-Sequenz und klicken Sie auf den Backbone-Slot. Um die Rückgratsequenz mit einer Schnittstelle für ein Restriktionsenzym zu linearisieren, klicken Sie auf die Schnittstelle, halten Sie die Umschalttaste gedrückt und klicken Sie erneut darauf. Drücken Sie Set Fragment, um das Rückgrat festzulegen.

Öffnen Sie Ihre nächste Insert-Sequenz und klicken Sie auf den Insert-Slot. Wählen Sie alle Basen des Einsatzes aus. Drücken Sie Set Fragment, um das erste Insert festzulegen.

Drücken Sie die Schaltfläche + rechts neben dem Montageassistenten, um einen weiteren Einsatz hinzuzufügen. Öffnen Sie den nächsten Insert und klicken Sie auf den neuen Insert-Slot. Wählen Sie erneut alle Basen des Einsatzes aus. Drücken Sie Set Fragment, um den zweiten Einsatz festzulegen.

Wenn Sie eine Spacer-Sequenz wie "kozak" zwischen zwei beliebigen Inserts hinzufügen möchten, klicken Sie auf die Schaltfläche Add Spacer After. Benennen Sie den Spacer „kozak“ und setzen Sie seine Basen auf gccacc. Drücken Sie Speichern, um die Abstandshaltersequenz einzustellen.

Wenn Ihre Baugruppe fertig ist, benennen Sie die Baugruppe in den gewünschten Konstruktnamen um und klicken Sie rechts neben dem Baugruppenassistenten auf Zusammenbauen.

Wählen Sie den gewünschten Ordnerspeicherort für den Sequenzordner und den Primer-Ordner aus. Klicken Sie auf Erstellen, um die Baugruppe abzuschließen.

Öffnen Sie das neu zusammengesetzte Konstrukt und klicken Sie auf das Verlaufsfeld, um die Sequenzlinie anzuzeigen. Beachten Sie, dass das Rückgrat und die Insert-Fragmente der zusammengesetzten Sequenz farbig sind.

Öffnen Sie die Registerkarte Baugruppe, um eine Übersicht über die Baugruppe anzuzeigen, sie auszudrucken oder die Primer zu exportieren.

Wenn Sie eine Ihrer Sequenzen in Ihrer Primer-Bindungsstelle ersetzen, aktualisiert Benchling den Primer automatisch und zeigt die Mutation in der Tabelle der Assembly-Registerkarte Eingeführte Fehlpaarungen an.

Um das Ausrichten an der zusammengesetzten Sequenz zu aktivieren oder beliebige Bearbeitungen daran vorzunehmen, öffnen Sie die Registerkarte Assembly und drücken Sie oben rechts auf Finalisieren.

Hinweis: Der Montageassistent erwartet nicht, dass Homologiearme in das Rückgrat/Insert integriert werden, da diese einfach miteinander verkettet werden.


Verweise

Hughes RA, Ellington AD. Synthetische DNA-Synthese und -Assemblierung: Das Synthetische in die synthetische Biologie einbringen. Cold Spring Harb Perspect Biol. 20179(1):1-17.

Ellis T, Adie T, Baldwin GS. DNA-Assembly für die synthetische Biologie: von Teilen zu Pfaden und darüber hinaus. Integrieren Sie Biol (Camb). 20113(2):109–18.

Cobb RE, Ning JC, Zhao H. DNA-Assembly-Techniken für die kombinatorische Biosynthese von Naturstoffen der nächsten Generation. J Ind Microbiol Biotechnol. 201441(2):469–77.

Chao R, Yuan Y, Zhao H. Jüngste Fortschritte in der DNA-Assembly-Technologie. FEMS Hefe-Res. 201515(1):1-9.

Juhas M, Ajioka JW. DNA-Assembly mit hohem Molekulargewicht in vivo für Anwendungen in der synthetischen Biologie. Crit Rev. Biotechnol. 201737(3):277–86.

Liang J, Liu Z, Low XZ, Ang EL, Zhao H. Twin-Primer nicht-enzymatischer DNA-Assembly: eine effiziente und genaue mehrteilige DNA-Assembly-Methode. Nukleinsäuren Res. 201745:e94.

Jin P, Ding W, Du G, Chen J, Kang Z. DATEL: eine narbenlose und sequenzunabhängige DNA-Assembly-Methode mit thermostabilen Exonukleasen und Ligase. ACS Synth Biol. 20165(9):1028–32.

Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatischer Zusammenbau von DNA-Molekülen bis zu mehreren hundert Kilobasen. Nat-Methoden. 20096(5):343–5.

Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate Shuffling: eine Eintopf-DNA-Shuffling-Methode basierend auf Restriktionsenzymen vom Typ IIs. Plus eins. 20094(5):e5553.

Bitinaite J, Rubino M, Varma KH, Schildkraut I, Vaisvila R, Vaiskunaite R. BENUTZERfreundliche DNA-Engineering- und Klonierungsmethode durch Uracil-Exzision. Nukleinsäuren Res. 200735(6):1992–2002.

de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB, Serber Z, Dean J, et al. Schnelle und zuverlässige DNA-Assemblierung durch Ligase-Cycling-Reaktion. ACS Synth Biol. 20143(2):97–106.

Shao Z, Zhao H. DNA-Assembler: ein Werkzeug der synthetischen Biologie zur Charakterisierung und Entwicklung von Naturstoff-Genclustern. Methoden Enzymol. 2012517:203–24.

Li MZ, Elledge SJ. Nutzung der homologen Rekombination in vitro, um rekombinante DNA über SLIC zu erzeugen. Nat-Methoden. 20074(3):251–6.

Zhang Y, Werling U, Edelmann W. SLiCE: eine neuartige DNA-Klonierungsmethode auf Basis von Bakterienzellextrakten. Nukleinsäuren Res. 201240(8):e55.

Tillett D, Neilan BA. Enzymfreies Klonen: eine schnelle Methode zum Klonen von PCR-Produkten unabhängig von Vektor-Restriktionsenzym-Schnittstellen. Nukleinsäuren Res. 199927(19):e26.

Stevenson J, Krycer JR, Phan L, Brown AJ. Ein praktischer Vergleich ligationsunabhängiger Klonierungstechniken. Plus eins. 20138(12):e83888.

Garcia-Nafria J, Watson JF, Greger IH. IVA-Klonierung: ein universelles Klonierungssystem mit einem einzigen Röhrchen, das die bakterielle In-vivo-Zusammensetzung nutzt. Sci Rep. 20166:27459.

Liu CJ, Jiang H, Wu L, Zhu LY, Meng E, Zhang DY. OEPR-Klonen: eine effiziente und nahtlose Klonierungsstrategie für große und mehrere Fragmente. Sci Rep. 20177:44648.

Zeng F, Hao Z, Li P, Meng Y, Dong J, Lin Y. Eine restriktionsfreie Methode zur Genrekonstitution unter Verwendung von zwei Single-Primer-PCRs parallel, um kompatible kohäsive Enden zu erzeugen. BMC Biotechnologie. 201717(1):32.

Cherezov V, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, et al. Hochauflösende Kristallstruktur eines konstruierten humanen beta2-adrenergen G-Protein-gekoppelten Rezeptors. Wissenschaft. 2007318(5854):1258–65.

Ikeda H, Nonomiya T, Usami M, Ohta T, Omura S. Organisation des biosynthetischen Genclusters für das Polyketid-anthelmintische Makrolid Avermectin in Streptomyces avermitilis. Proc Natl Acad Sci U S A. 199996(17):9509–14.

Garrido LM, Lombo F, Baig I, Nur EAM, Furlan RL, Borda CC, Brana A, Mendez C, Salas JA, Rohr J, et al. Einblicke in die Glykosylierungsschritte während der Biosynthese des Antitumor-Anthrazyklin-Cosmomycin: Charakterisierung zweier Glykosyltransferase-Gene. Appl Microbiol Biotechnol. 200673(1):122–31.

Piel J, Hertweck C, Shipley PR, Hunt DM, Newman MS, Moore BS. Klonierung, Sequenzierung und Analyse des Enterocin-Biosynthese-Genclusters aus dem marinen Isolat „Streptomyces maritimus“: Beweis für die Entgleisung einer aromatischen Polyketid-Synthase. Chem. Biol. 20007(12):943–55.

He J, Hertweck C. Iteration als programmiertes Ereignis während der molekularen Analyse des Polyketid-Assemblys des Aureothin-Biosynthese-Genclusters. Chem. Biol. 200310(12):1225–32.

Yurkovich ME, Tyrakis PA, Hong H, Sun Y, Samborskyy M, Kamiya K, Leadlay PF. Eine späte Zwischenstufe der Salinomycin-Biosynthese wird durch eine spezifische Mutation im biosynthetischen Gencluster aufgedeckt. Chembiochem. 201213(1):66–71.

Dagert M, Ehrlich SD. Eine längere Inkubation in Calciumchlorid verbessert die Kompetenz der Escherichia coli-Zellen. Gen. 19796(1):23–8.


Vorteile der GeneArt Gibson Assembly Cloning-Technologie

GeneArt Gibson EX-Montagesätze sind ideal für die Montage mehrerer Einsätze.

Abbildung 1. GeneArt Gibson Assembly EX Cloning Kits bieten Optionen für eine hohe Transformationseffizienz, wenn eine größere Anzahl von Inserts verwendet wird. Zusammenbau von 6, 8 und 10 Fragmenten von 0,5 kb in pcDNA 3.4, transformiert in Invitrogen TOP10 kompetente Zellen.

GeneArt Gibson Assembly HiFi Kits bieten eine sehr kostengünstige und effiziente Möglichkeit, kleinere Stückzahlen zusammenzubauen. Für größere Baugruppen stehen die GeneArt Gibson EX Master Mixes und Kits zur Verfügung.

Abbildung 2. GeneArt Gibson Assembly HiFi-Kits bieten eine hohe Kloneffizienz unter Verwendung eines einzelnen Inserts für mehrere Insert-Designs. Zusammenbau von 1, 2 und 4 - 1 kb Fragmenten in pCDNA 3.4 unter Verwendung von TOP10 kompetenten Zellen. GeneArt Gibson Assembly HiFi Kits sind die kostengünstigste und zeitsparendste Methode zum Bau großer Baugruppen, insbesondere wenn sie mit GeneArt Strings DNA Fragments oder 100 % sequenzierter GeneArt Gensynthese verwendet werden.


So funktioniert die Gibson-Montage

Die Anwendung der rekombinanten DNA-Technologie begann kurz nach der Entdeckung der DNA-Ligase und der Restriktionsendonukleasen. Bald darauf eröffnete die Einführung der Polymerase-Kettenreaktion (PCR) neue Möglichkeiten zur Amplifikation spezifischer DNA-Sequenzen aus einem komplexen Gemisch genomischer DNA. Diese Technologien sind seit mehreren Jahrzehnten eine tragende Säule im modernen wissenschaftlichen Labor und sind auch heute noch nützliche Methoden zum Klonen potenziell wertvoller oder interessanter DNA. Da Wissenschaftler jedoch versuchen, mit größeren DNA-Fragmenten zu arbeiten, umfangreiche Neuentwicklungen genetischer Elemente durchzuführen, ganze Genome zu synthetisieren und zu automatisierten Ansätzen überzugehen, müssen sich auch die zur Manipulation der DNA erforderlichen Technologien weiterentwickeln.

Forscher des J. Craig Venter Institute (JCVI) haben eine Reihe von in vitro enzymatische Strategien zum Zusammenbau kurzer Oligonukleotide zu größeren doppelsträngigen DNA-Konstrukten (1-4). Im Jahr 2003 machte JCVI einen bedeutenden Fortschritt bei der Herstellung eines synthetischen Genoms, indem es das 5.386 bp-Genom von phiX174, einem Virus, das Bakterien infiziert, in nur 14 Tagen zusammensetzte (5). Dieser Ansatz beinhaltete das Verbinden synthetischer Oligonukleotide durch Polymerase-Cycling-Assemblierung und die anschließende Amplifikation durch PCR (5-6). Die beispiellose Geschwindigkeit, mit der dies abgeschlossen wurde, legte den Grundstein für die Konstruktion größerer und komplexerer Genome.

Im Jahr 2004 begann JCVI mit der Synthese der Mycoplasma genitalium Genom. Es wurde festgestellt, dass überlappende DNA-Moleküle mithilfe von drei Enzymspezifitäten effizient verbunden werden können: (i) Exonuklease-Aktivität, die die Enden von DNA-Fragmenten zurückkaut und ssDNA-Überhänge freilegt, die an ihr ssDNA-Komplement anlagern können (ii) DNA-Polymerase-Aktivität, die die Lücken in den angelagerten Produkten und (iii) DNA-Ligase-Aktivität, die die resultierenden Nicks in der Anordnung kovalent versiegelt. Ein zweistufiger Thermozyklus-basierter in vitro Rekombinationsmethode unter Verwendung dieser Enzyme wurde verwendet, um 101 überlappende DNA-Kassetten in vier Teile der M. genitalium Genom, jeweils zwischen 136 kb und 166 kb groß. Dieser Meilenstein markierte den ersten Zusammenbau eines Genoms, das von einem freilebenden Organismus abgeleitet wurde. Mit 582.970 bp war dieses synthetische Genom die größte chemisch definierte DNA-Struktur, die in einem Labor synthetisiert wurde, und war 18-mal größer als jede zuvor synthetisierte DNA (4).

Seitdem zwei zusätzliche in vitro Rekombinationsverfahren wurden von JCVI entwickelt, um DNA-Moleküle, die größer als 300 kb sind, in einem einzigen Schritt zu verbinden und zu klonieren (2-4). Die einfachste dieser Methoden ist die Gibson-Assemblierung, ein einstufiger isothermer Ansatz, der dieselben drei zuvor beschriebenen enzymatischen Aktivitäten nutzt. Diese Methode kann verwendet werden, um sowohl ssDNA als auch dsDNAs zu verbinden.

Abbildung 1. Übersicht über die Gibson-Baugruppe.


Gibson Assembly ist die am häufigsten verwendete der in vitro oben besprochenen Montagemethoden, da es einfach zu handhaben, flexibel ist und selbst bei großen, komplexen Baugruppen wenig oder keine Optimierung benötigt. Alles, was erforderlich ist, ist die Eingabe von DNA mit entsprechenden Überlappungen und eine geeignete Mischung der drei Enzyme und der Gibson Assembly Master Mix. DNA-Fragmente werden dem Mastermix zugesetzt und 1 Stunde bei 50 °C inkubiert. Das resultierende Assemblierungsprodukt ist eine vollständig versiegelte dsDNA, die für eine Reihe von Downstream-Anwendungen geeignet ist (Abbildung 1). JCVI hat Gibson Assembly verwendet, um das gesamte mitochondriale Genom der Maus mit 16.520 bp aus 600 überlappenden 60-Basen-Oligonukleotiden schnell zu synthetisieren (3). Es wurde auch in Kombination mit Hefe-Assembly verwendet, um die 1.1 Mbp . zu synthetisieren Mykoplasmen-Mykoide Genom, das dann in einer Empfängerzelle aktiviert wurde, um die erste synthetische Zelle zu produzieren (1).


Siehe unten für eine konsolidierte Version.

Bereiten Sie Plasmidkarten vor

  • Erstellen Sie eine Plasmidkarte, wie Ihr fertiges Design aussehen soll
    • Dies ist der Schlüssel. Sie werden es für das Primer-Design, die Überprüfung Ihrer Primer, die Bewertung von Sequenzierungsreaktionen usw. benötigen. Ich verwende APE, Open-Source-Software. Siehe meine APE-Verwendungskommentare in Tipps und Tricks.
    • Dies bedeutet meistens das Kopieren von anderen Plasmidsequenzen und das Einfügen in eine neue Plasmiddatei.
      • Sie können jedoch kürzere Elemente wie Promotoren und Ribosomenbindungsstellen hinzufügen, indem Sie sie in Ihren Primern codieren.
      • Sie können auch längere DNA-Regionen hinzufügen, indem Sie längere (90+ bp) Oligos verwenden
      • Sie können genomische DNA verwenden, normalerweise aus ganzen Zellen (keine vorherige Reinigung erforderlich)
      • Stellen Sie sicher, dass jedes Gen einen Promotor, eine RBS und ein Stoppcodon hat, falls gewünscht.
      • Wenn Sie mit Ihren Sequenzen nicht vertraut sind, stellen Sie sicher, dass die Sequenz keine Stoppcodons im Frame mit dem Start hat.
      • Schließen Sie die durch die Primer erzeugte Überlappung ein.

      Designgrundierungen

      • Das Primer-Design ist der Schlüssel. Wenn alle Ihre PCRs bei allen getesteten Thermocycling-Bedingungen eine gute Ausbeute ohne unerwünschte Banden liefern, wird Ihr Zusammenbau sehr wahrscheinlich gut verlaufen.
        • Es ist immer ein gutes Zeichen, wenn Primer bei mehreren Annealing-Temperaturen arbeiten, die einige oC voneinander entfernt sind, und über DMSO-Konzentrationen hinweg. Da der Zusammenbauschritt so von der Primersequenz und dem Fehlen einer einzelsträngigen DNA-Struktur (Haarnadeln usw.) abhängt, ist die Einfachheit der PCR ein guter Indikator dafür, ob der Zusammenbau wahrscheinlich gut verläuft.
        • Wenn Ihr Rückgrat nicht gut amplifiziert oder sich mit Nebenprodukten amplifiziert und eine Gelreinigung erfordert, ist die Wahrscheinlichkeit, dass Sie erfolgreiche Assemblierungen erhalten, viel geringer. Wenn eine schlechte PCR erzeugt wird, erwägen Sie, die Annealing-Temperatur der Bindungsregion für den Primer > 72 °C zu erhöhen und wenn möglich verschiedene Bereiche des Vektors für die Überlappung zu verwenden.
        • ich immer Primer mit Tm >72 o C . verwenden für den Glühbereich. Tm Werte sollten immer von der Finnzymes-Website berechnet werden
          • Diese Formel gilt für die Phusion DNA-Polymerase, die DNA-Polymerase, die verwendet wird, um die DNA zu erzeugen, die Sie zusammenbauen werden.

          Überprüfe dein Design noch einmal

          • Stellen Sie sicher, dass die von Ihnen bestellten Vorwärtsprimer und Rückwärtsprimer der beabsichtigten Richtung entsprechen.
            • Dies ist ein einfacher Fehler.

            Optimale Bedingungen finden

            Dpn1-Verdau von Template-DNA

            • Dpn1 sollte normalerweise hinzugefügt werden nachdem die PCR abgeschlossen ist, um die Matrizen-DNA abzubauen. Dadurch wird die Anzahl der Hintergrundkolonien bei der Transformation reduziert. Bei der Gelreinigung von Fragmenten ist dies normalerweise nicht erforderlich, jedoch sollte die Gelreinigung, wie hierin erörtert, vermieden werden.
              • Dies dient dazu, ein Durchführen von Vorlagen zu vermeiden.
                • Wenn die Templates für Ihre PCRs Kanamycin-Vektoren sind und Sie einen Kanamycin-Vektor bauen, dann wird ein Teil Ihrer Transformanten nur Zellen sein, die das/die Template-Plasmid(e) durchlaufen. Dies muss später beim Screening berücksichtigt werden.
                • Wenn Sie ein Fragment eines Amp-Plasmids haben und einen Kanamycin-Vektor erstellen, ist es nicht erforderlich, Dpn1 hinzuzufügen.

                0,5 ng Template-Plasmid pro 25 ul PCR-Reaktion, um mein Rückgrat herzustellen, dann säulengereinigt (nicht gelgereinigt!) und kein Dpn1-Verdau durchgeführt. Die rosafarbenen Kolonien sind die Plasmidmatrize, die die Säulenreinigung in den Zusammenbaureaktions- und Transformationsschritt durchführt.

                Warnungen

                • Achten Sie besonders darauf, dass Sie die richtige Kombination von Primern verwenden, wenn Sie mehrere Fragmente von einem Plasmid amplifizieren oder wenn Ihre Primer über Templates hinweg funktionieren, die für eine Zusammenstellung verwendet werden.
                  • Beispiel: Ich habe einmal einen Vektor getrimmt und die falsche Primerkombination für das Rückgrat verwendet. Die Bande auf dem Gel erschien korrekt (400 bp Unterschied auf einem 5-kb-Rückgrat ist subtil), führte jedoch zu Anordnungen, bei denen nur eine der beiden Nähte korrekt war.

                  Machen Sie genug zum Reinigen und Zusammenbauen

                  • Führen Sie Reaktionen im Reinigungsmaßstab durch, um DNA für den Zusammenbau herzustellen
                    • Wenn Ihr Produkt spezifisch ist und nicht gelgereinigt werden muss: (nur PCR-Reinigung erforderlich)
                      • 20 ul eines stark amplifizierten Inserts sind ausreichend. Tun Sie ein bisschen mehr (30uL), wenn es das Rückgrat ist. Diese Mengen liefern normalerweise viel DNA für 5+-Assemblies, was die Möglichkeit für mehrere Versuche ermöglicht.
                      • laufen eher wie 60-120 ul, je nachdem, wie schlecht die Nebenprodukte sind.

                      Aufreinigung von PCR-Fragmenten

                      • Der beste Weg zur Reinigung von PCR-Produkten ist eine einfache Säulenreinigung. Wir verwenden das Qiagen PCR Cleanup Kit und eluieren in Wasser.
                        • Dies erfordert normalerweise, dass Ihre PCRs sehr spezifisch für die gewünschte Bandengröße waren. Aus diesem Grund werden PCR-Primer mit Schmelztemperaturen von 70 °C hergestellt: Annealing bei einer hohen Temperatur (67-70 °C) ist der wahrscheinlichste Weg, um die gewünschte PCR-Amplifikation zu erzielen. Sie müssen überprüft haben
                        • Dadurch werden Primer-Dimere und unerwünschte Banden entfernt. Leider haben die säulenbasierten Gelextraktionskits eine extrem niedrige Effizienz. Sie können in Wasser oder dem im Kit bereitgestellten Puffer eluieren (vorausgesetzt, es sind nur 10 mM Tris, pH 8,5 & hat kein EDTA), aber ich habe immer Wasser verwendet.
                        • Eluieren Sie in 30 µl (nicht 50 µl), um ein konzentriertes Produkt zu erhalten.

                        100 ul PCR-Produkt ergeben normalerweise

                        Nano Drop PCR-Fragmente

                        • Führen Sie 1,5 ul auf einem NanoDrop-Gerät aus, um die DNA-Konzentration jedes Eluats anzunähern.
                        • Sie können den 1,5-uL-Lauf auf der Maschine in ein Agarosegel verwenden, um sicherzustellen, dass die Produkte gut aussehen und nicht versehentlich während der Reinigung vermischt wurden.
                        • Beispiel:

                        Gibson Montagereaktion

                        • Fügen Sie Ihre gereinigten PCR-Produkte hinzu und fügen Sie Wasser hinzu, um die gewünschte Konzentration zu erreichen, wie in Ihrem kommerziellen Kit oder Hausbraurezept angegeben.
                          • Das im Handel erhältliche Kit funktioniert

                          Transformation

                          • Normalerweise wird Elektroporation verwendet, da Sie damit eine viel höhere Effizienz erzielen können. Einige Leute verwenden jedoch chemisch kompetente Zellen, die ausreichen können, wenn der Zusammenbau einfacher ist. Wie viel DNA Sie umwandeln und ob Sie sie zuerst entsalzen müssen, hängt von Ihrer erwarteten Montageeffizienz und Produkttoxizität ab.
                          • Das Entsalzen von DNA für 15 Minuten auf Millipore-Filtern bedeutet, dass Sie mehr DNA zu Elektroporationen hinzufügen können und keine Lichtbögen entstehen.
                            • Wir verwenden Millipore-Entsalzungspapier, Artikel-Nr. VSWP01300 zum Entsalzen von 12-20 uL-Reaktionen und Millipore # VSWP02500 für größere Volumina. Legen Sie die gesamte Baugruppe auf einen Filter, der auf dem Wasser schwimmt.
                            • Aaron Puri wartet 15 Minuten Entsalzung und elektroporiert bei 1,6 kV ohne Lichtbogen. -6/2015. Es schadet nicht, sie länger zu lassen.

                            • Kann viel effizienter sein als chemisch kompetente Zellen.
                            • Verwenden

                            • Wenn Sie den kommerziellen Montagemix verwendet haben und Ihr Design (a) nicht zu kompliziert ist (zu viele Teile, zu großes Endprodukt, zu giftig für Gene) und (b) in sehr gute (konzentrierte) elektrokompetente Zellen umgewandelt wurde, dann können 1-2 ul Ihnen genug Kolonien geben, um einen Rasen zu haben.
                            • Vielleicht möchten Sie einige umwandeln un-zusammengesetzte Fragmente, um ein Gefühl dafür zu bekommen, was die Hintergründe der wirklichen Transformation sind. (Einige der Kolonien, die auf der Transformationsplatte wachsen, haben trotz Dpn1-Verdau Templat-DNA, nicht das gewünschte Konstrukt.
                            • Wenn Sie Plasmide ausplattieren, die Ampicillin-Resistenz verleihen, plattieren Sie auf Carbenicillin und nicht auf Ampicillin.
                              • Ampicillin ist dafür berüchtigt, Satellitenkolonien oder sogar Rasen mit nicht resistenten Bakterien zu erzeugen. Dies ist insbesondere dann ein Problem, wenn Ihr zusammengesetztes Plasmid zu langsamem Wachstum führt, da die nicht resistenten Bakterien viel Zeit zum Gedeihen haben. Wenn Ihre elektrokompetenten Zellen gut sind, führt die hohe Zelldichte wahrscheinlich zu einem Bakterienrasen auf einer Amp-Platte, auch wenn die meisten Bakterien nicht Amp-resistent sind. Sie könnten einen kleinen Teil Ihrer Elektroporation auf Amp plattieren, aber das setzt voraus, dass Sie eine hohe Montageeffizienz und ein Plasmid mit geringer Belastung haben (z.

                              Screening: Kolonie-PCR

                              Verwenden Sie Kolonie-PCR, um PCR-Fragmente zu generieren, die Ihre Zusammenstellung bestätigen.

                              • Verwenden Sie dafür nicht Phusion, es ist viel zu wertvoll.
                              • Ich verwende [2X OneTaq http://www.neb.com/nebecomm/products/productM0486.asp] PCR-Mix aus mehreren Gründen:
                                • Es ist billig
                                • Es kann im Kühlschrank, aufgetaut, monatelang ohne Schaden aufbewahrt werden.
                                • Es hat bereits Ladefarbstoff, so dass das Laden in Agarosegelen zur Beobachtung beschleunigt wird.
                                • Spitze: Stellen Sie etwa 1/2 ml Wasser und Kolonie-PCR-Primer in geeigneten Anteilen für die endgültige 1x-Mischung her. Die Mischungsverhältnisse finden Sie in dieser Tabelle. Machen Sie weiter und machen Sie 1/2 ml, Sie können froh sein, dass Sie später mehr haben und Wasser / Grundierungen fast kostenlos sind. Sie können Reste unbegrenzt im Kühlschrank aufbewahren. Ich beschrifte meinen OneTaq 212 213, wenn ich die Primer 212 und 213 eingemischt habe. Wenn Sie dann eine Kolonie-PCR durchführen, können Sie 6 ul dieser Mischung in jede Vertiefung geben, Zellen in jeder Vertiefung auflösen und Fügen Sie 6 ul der 2x-Mischung hinzu.
                                • Alternativ können Sie eine 1x-Mischung herstellen (das erforderliche Wasser und die Grundierungen hinzufügen) und die Mischung nach vielen Gefrier-Auftau-Zyklen verwenden.
                                • PCR über eine Region, die eine andere Länge hat als jedes Ihrer Template-Plasmide. Auf diese Weise können Sie feststellen, welche Baugruppen erfolgreich und welche Vorlagenübertragen sind.
                                  • Wenn Sie ein Gen in einem Plasmid geändert haben und die Gengröße unterschiedlich ist, PCR für die Länge dieser Region.
                                    • Sie können eine PCR über das gesamte Insert durchführen, wenn Sie in einen leeren Vektor eingefügt haben und Ihre Templates nicht amplifiziert werden, um die gleichen Produktgrößen zu ergeben.
                                    • Sie können sich entscheiden, Kolonien, die Sie vor oder nach dem Vorliegen Ihrer Ergebnisse getestet haben, erneut zu plattieren. Ich streiche immer einmal nach, um einzelne Kolonien zu erhalten, um die Wahrscheinlichkeit zu verringern, dass mein Miniprep eine gemischte Population ist.
                                      • Ich plattiere gleichzeitig, ich probiere, wenn:
                                        • Ich denke, der Anteil, der erfolgreich ist (nicht die Vorlage), wird hoch sein
                                        • Ich lasse die PCR über Nacht laufen und erhalte die Ergebnisse erst am Morgen.
                                        • Ich denke, die Ergebnisse werden hauptsächlich die Übertragung von Template-Plasmiden sein
                                        • Ich werde Gelegenheit haben, die PCR-Produkte in einem Gel laufen zu lassen, bevor ich für den Tag aufbreche, so dass ich nur "Gewinner" wiederholen kann.
                                        1. Entscheiden Sie, wie viele Kolonien Sie überprüfen möchten. Bereiten Sie einen PCR-Streifen (oder Streifen) mit nummerierten Vertiefungen vor, die den Koloniennummern entsprechen.
                                          1. Ich verwende 12er-Sets, da meine Agarosegele dafür genügend Bahnen und zwei Leiterbahnen haben. Sie werden mindestens eine der Vertiefungen verwenden, um die Template-DNA als Kontrolle zu amplifizieren. Ich mache mehr Kolonien (bis zu 33-34), wenn ich erwarte, dass das Durchführen von Templates ein Problem ist, oder wenn die Gene toxisch sind und erfolgreiche Assemblierungen die Zellen ungesund machen.
                                          2. Wenn Sie jede getestete Kolonie erneut ausstreichen, bereiten Sie Ihre Platten jetzt vor. Ich teile den Teller in 6 Tortenscheibenformen.
                                          1. Wenn Sie zu Beginn neu plattieren, markieren Sie auch die Kreisscheibenbereiche mit denselben Nummern.
                                          1. Wenn Sie jetzt Kolonien nachstreichen: Wischen Sie ein wenig von der Kolonie auf der Platte ab und lösen Sie den Rest in der entsprechend nummerierten PCR-Vertiefung auf.
                                          2. Wenn Sie die Kolonien jetzt nicht erneut ausstreichen, versuchen Sie, etwas Biomasse auf der Platte zu belassen, aber seien Sie versichert, dass immer noch Zellen übrig sind, es sei denn, Sie haben wirklich ein Loch in die Agarose gestanzt.
                                          3. Bei sehr großen Kolonien kann man es überladen und viel mit der Pipettenspitze aufsaugen.
                                          4. Sobald sich in einer bestimmten PCR-Vertiefung eine Kolonie aufgelöst hat, werfen Sie die Pipettenspitze in die dahinterliegende Vertiefung. Neben der Nummerierung jedes Wells und der Nummerierung und Einkreisung der Kolonien auf der Transformationsplatte ist dies ein zusätzlicher Schutz, um sicherzustellen, dass nur eine Kolonie in jede PCR-Reaktion eingesetzt wird.

                                          Sequenzierung

                                          • Wählen Sie 2-4 Kolonien für die Sequenzierung basierend auf der Kolonie-PCR
                                          • Führen Sie zuerst die Nähte der Gibson-Baugruppe in Reihenfolge.
                                          • Sequenzieren Sie die anderen Regionen, da möglicherweise ein PCR-Fehler eingeführt wurde
                                            • Wenn ein "Fehler" gefunden wird, war er normalerweise tatsächlich auf der Vorlage vorhanden.

                                            Entwerfen von Primern für Gibson Assembly mit MacVector 17

                                            MacVector 17 verfügt über ein völlig neues Werkzeug zum automatisierten Design von Ligase-unabhängigen Klonierungsstrategien. Das Tool unterstützt die 5’-Exonuklease-getriebene Gibson-Assemblierung sowie den T4 DNA Polymerase 3’-Exonuklease-Ansatz „Ligase Independent Cloning“. MacVector kann automatisch Primer entwerfen, wenn Sie die zu verwendenden Fragmente und Vektoren angeben. Sie können benutzerdefinierte Primer bereitstellen (manuell oder über Tools wie die NEBuilder-Website). Sie können auch einfach vorhandene Fragmente mit überlappenden Enden versehen, damit MacVector sie zusammenbauen kann. Die Schnittstelle zeigt die genaue Struktur der Verbindungen zwischen Fragmenten, einschließlich relevanter CDS-Translationen zur Bestätigung des Rahmens von Proteinfusionen. Die Klonstrategie kann als neues Klonprojektdokument gespeichert und schließlich für den Export automatisch zu einer einzigen Sequenz zusammengefügt werden.

                                            MacVector 17 wurde im Februar 2019 veröffentlicht. Es enthält brandneue Tools zum Vergleich von Genomen, die das Klonen von Restriktionsenzymen vereinfachen, das automatisierte Design von Gibson/LIC-Klonierungsstrategien, das Hervorheben von Montageproblemen, den Vergleich mehrerer Sequenzdatensätze mit einer einzigen Referenz und die Erstellung von Plasmidkarten noch mehr schön, indem Sie Ihre eigenen Primer-Bindungsstellen anzeigen! Schließlich unterstützt MacVector 17 den Dark Mode von macOS Mojave, um die Konzentration auf diese nächtlichen Primer-Designsitzungen zu unterstützen!


                                            Leistungsdaten

                                            Sehen Sie, wie NEBuilder HiFi die NEB Gibson Assembly übertrifft.

                                            Verbesserte Effizienz und Genauigkeit

                                            Verbesserte Wiedergabetreue

                                            Eines oder mehrere dieser Produkte sind durch Patente, Warenzeichen und/oder Urheberrechte geschützt, die New England Biolabs, Inc. gehören oder von ihr kontrolliert werden. Für weitere Informationen senden Sie uns bitte eine E-Mail an [email protected] . Die Verwendung dieser Produkte kann es erforderlich machen, dass Sie für bestimmte Anwendungen zusätzliche geistige Eigentumsrechte Dritter erwerben. .

                                            GIBSON ASSEMBLY® ist ein eingetragenes Warenzeichen von Synthetic Genomics, Inc.


                                            Schau das Video: How to design qPCR primers create Real time PCR primers by BLAST طراحی پرایمر با پرایمر بلاست (November 2022).