Information

Bedarf an zwei Sauerstoffsensoren bei E. coli

Bedarf an zwei Sauerstoffsensoren bei E. coli


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

E coli hat zwei Sauerstoffsensoren: FNR (Fumarat-Nitrat-Reduktase) und ArcBA (Anoxic Redox Control, Zweikomponenten-Kontrollsysteme). FNR erfasst den Sauerstoff direkt, während die Wechselwirkung von ArcB mit Sauerstoff indirekt über den Chinonpool erfolgt. Aus den Quiononen rein E coli, welche (oxidierte und reduzierte Formen aller drei Typen) in welchem ​​Ausmaß in welche Richtung (inhibierend/aktivierend) eine Rolle spielen, ist umstritten. Ich würde gerne einige intuitive Argumente sehen, warum eine Zelle prinzipiell zwei Sensoren für Sauerstoff benötigt?


Es ist nicht ungewöhnlich, dass Zellen parallele Wege für das gleiche Ergebnis haben. Dies gewährleistet eine narrensichere Reaktion und macht das System robust. E coli hat auch einen weiteren Sensor für Aerotaxis (Aer- und Tsr-Proteine). Siehe meine Antwort in Ihrem vorherigen Beitrag und dem verlinkten Papier.

Suchen Sie auch nach kohärenten Feed-Forward-Netzwerkmotiven.


Sauerstoff- und Redoxsensorik durch Zweikomponentensysteme, die Verhaltensreaktionen regulieren: Verhaltenstests und Strukturstudien von Luft unter Verwendung von In-vivo-Disulfid-Vernetzung

Ein bemerkenswerter Anstieg der Anzahl annotierter Aerotaxis- (sauerstoffsuchender) und Redox-Taxis-Sensoren kann auf die jüngsten Fortschritte in der bakteriellen Genomik zurückgeführt werden. In-silico-Vorhersagen sollten jedoch durch Verhaltenstests und genetische Analysen unterstützt werden, die eine Aerotaxis- oder Redox-Taxis-Funktion bestätigen. Dieses Kapitel stellt eine Sammlung von Verfahren vor, die bei der Charakterisierung von Aerotaxis und Redox-Taxis bei Escherichia coli sehr erfolgreich waren. Die Methoden sind so detailliert beschrieben, dass Forscher anderer Arten die Verfahren für ihre Anwendung anpassen können. Eine Gasdurchflusszelle wird verwendet, um die zeitlichen Reaktionen von Bakterien auf eine schrittweise Zunahme oder Abnahme des Sauerstoffpartialdrucks oder des Redoxpotentials zu quantifizieren. Das Bakterienverhalten in räumlichen Gradienten wird mit optisch flachen Kapillaren und Weichagarplatten (Succinat-Agar oder Trypton-Agar) analysiert. Wir beschreiben zwei Ansätze, um den bevorzugten Sauerstoffpartialdruck abzuschätzen, der eine Bakterienart anzieht. Diese Konzentration ist wichtig für das Verständnis der mikrobiellen Ökologie. Auf molekularer Ebene beschreiben wir Verfahren zur Bestimmung der Struktur und Topologie von Aer, einem Membranrezeptor für die Aerotaxis. Cystein-Scanning-Mutagenese und In-vivo-Disulfid-Vernetzungsverfahren verwenden das Oxidationsmittel Cu(II)-(1,10-Phenanthrolin)(3) und bifunktionelle Sulfhydryl-reaktive Sonden. Schließlich beschreiben wir Methoden, die verwendet werden, um die Grenzen von Transmembransegmenten von Rezeptoren wie Aer zu bestimmen. Dazu gehören 5-Iodacetamidofluorescein, 4-Acetamido-4-disulfonsäure, Dinatriumsalz (AMS) und Methoxypolyethylenglykolmaleimid, eine 5-kDa-Molekularmassensonde, die die Mobilität von Aer auf SDS-PAGE verändert.


Hintergrund

Nicht-invasiver Nachweis von intrazellulärem O2 ist von besonderer Bedeutung, da es einer der Schlüsselmetaboliten von obligaten und fakultativ aeroben Organismen ist. Mobilfunk O2 ist ein prominenter Indikator für sauerstoffabhängige Stoffwechselaktivitäten, wie aerobe Atmung oder sauerstoffabhängige Synthese und Abbau von Zellbestandteilen [1, 2]. Darüber hinaus werden verschiedene biologische, pathologische und biotechnologische Prozesse von O . gesteuert2 Einschränkung, einschließlich Biofilmbildung und Wirt-Pathogen-Interaktionen [3–7], durch Hypoxie induzierte Entzündungsprozesse [8], Tumorpathophysiologie [9–12] sowie mikrobielle Fermentationsprozesse zur Bioremediation und zur Herstellung von Nahrungs- und Futtermitteln und Biokraftstoffen [ 13–16].

Bis heute verschiedene minimal-invasive Fluoreszenz- und Phosphoreszenz-basierte O2-sensitive Sonden wurden entwickelt, um molekularen Sauerstoff in Zellen und Geweben abzubilden. Unter diesen werden Platin(II)-Porphyrin-Farbstoffe häufig zur Analyse von durch Hypoxie induzierten Reaktionen von Säugerzellen verwendet [17–19]. Alternativ können das grün fluoreszierende Protein (GFP) und seine Varianten als genetisch kodierte intrazelluläre Sonden verwendet werden, die spezifisch exprimiert werden und selektiv in definierten Zellen und Geweben angesteuert werden können. In diesem Zusammenhang wurden mindestens zwei „passive“ GFP-basierte Sauerstoffsensoren entwickelt, um den intrazellulären Sauerstoffgehalt in E coli. Hier wurde GFP als Reporterprotein verwendet, das unter Kontrolle von Sauerstoff-responsiven . exprimiert wird E coli Promotoren [20, 21]. Darüber hinaus wurde die sauerstoffempfindliche Photoaktivierung von GFP-vermittelter roter Fluoreszenz für in vivo Abbildung von Sauerstoff in Säugerzellen und -organen [22–24].

Bemerkenswert ist, dass molekularer Sauerstoff derzeit nicht analysiert werden kann in vivo durch genetisch kodierte FRET-basierte Biosensoren, obwohl diese Biosensoren eine der am weitesten verbreiteten Klassen fluoreszierender molekularer Sonden darstellen, die für die nicht-invasive quantitative Analyse intrazellulärer Verbindungen einschließlich Ca 2+ , Zn 2+ , Cl – , pH, H . verwendet werden2Ö2, ATP, Maltose, Saccharose, Ribose und Glucose [25–27]. In Bezug auf die Sauerstoffsensorik weisen GFP-ähnliche Proteine, die üblicherweise als Donor- und Akzeptordomänen von FRET-Biosensoren verwendet werden, jedoch einen großen Nachteil auf: Ihre autokatalytische Chromophorsynthese hängt strikt von der Anwesenheit von molekularem Sauerstoff ab [28, 29] und damit die Intensität des Fluoreszenzsignals spiegelt grundsätzlich nicht die Menge des synthetisierten Reporterproteins wider [30]. Daher können GFP und seine Farbvarianten nicht nur als fluoreszierende Biosensordomänen für genaue O2 Festlegung.

Vor kurzem haben wir eine neue Klasse fluoreszierender Proteine ​​entwickelt, die Flavinmononukleotid (FMN) als Chromophor tragen [31]. Im Gegensatz zu GFP-ähnlichen FPs ist das Fluoreszenzsignal dieser FMN-basierten fluoreszierenden Proteine ​​(FbFP) unabhängig vom zellulären Sauerstoff und somit kann FbFP quantitativ verwendet werden in vivo Echtzeit-Reporterprotein sowohl unter aeroben als auch unter anaeroben Bedingungen [30, 31]. Hier berichten wir über den Bau und die Anwendung des ersten genetisch kodierten FRET-basierten Biosensors für Sauerstoff namens FluBO, der aus der sauerstoffunempfindlichen FbFP-Donordomäne und der hypoxieempfindlichen verstärkten gelben Fluoreszenzprotein (YFP)-Akzeptordomäne besteht. Wir zeigen weiter, dass seine FRET-Effizienz dynamisch auf sich ändernde O . reagiert2 Werte in lebenden Bakterienzellen.


Einführung

Rhizobien sind Alpha-Proteobakterien, die mit Hülsenfrüchten eine Symbiose eingehen [1]. Die Bakterien wandeln inertes atmosphärisches N . um2 in biologisch zugängliches Ammoniak umzuwandeln und es in einem Prozess namens Stickstofffixierung ihrem Wirtspflanzen zur Verfügung zu stellen [2,3]. Die gesamte biologische Fixierung wird durch den Nitrogenase-Enzymkomplex katalysiert, der sich vor dem Großen Oxygenierungsereignis entwickelt hat und nahezu anoxische Bedingungen erfordert, um zu funktionieren [4–6]. Rhizobien sind jedoch obligate Aerobier und müssen atmen, um den hohen Energiebedarf der Stickstofffixierung zu decken [7,8]. Diese konkurrierenden Anforderungen schaffen ein „Sauerstoffparadox“ bei der symbiotischen Stickstofffixierung [9,10]. Um dieses Paradoxon zu überwinden, hat sich eine komplizierte Zusammenarbeit zwischen Rhizobien und ihren Pflanzenpartnern entwickelt (Übersicht in [11,12]). Hülsenfrüchte beherbergen Rhizobien in speziellen Wurzelknollen, die sich dort bilden, wo Bakterien in die Pflanzenwurzel eingedrungen sind, normalerweise über Infektionsfäden (Übersicht in [13,14]). Knötchen schaffen eine nahezu anoxische interne Umgebung, die für die Nitrogenaseaktivität geeignet ist [15-17]. Um diese Umgebung zu erzeugen, muss Sauerstoff (O2) wird von pflanzlichen Leghämoglobinen eingefangen und zu Bakteroiden transportiert [18–21]. Die Konzentration des verbleibenden freien O2 in der Kern-Stickstoff-Fixierungszone der Knötchen liegt bei nur 20–50 nM [22,23]. Rhizobien unterliegen nach dem Eintritt in den Knoten einer radikalen Änderung des Lebensstils, um unter diesen Bedingungen zu überleben und Stickstoff zu fixieren (überprüft in [24,25]). In unbestimmten Knötchen, wie sie von Pisum sativum (Erbse) sind Rhizobien bei der Einreise zunächst freilebend [26,27]. Sie unterliegen dann irreversiblen Veränderungen des Lebensstils, wenn sie sich von der Knötchenspitze zu ihrem Kern bewegen [28,29]. Beginnend in Zone II und beschleunigt in der II-III-Interzone differenzieren sich Rhizobien schließlich in Quasi-Organellen-Bakteroiden, die auf die Stickstofffixierung spezialisiert sind [30,31]. Zone III unbestimmter Knötchen enthält differenzierte Bakteroide, die aktiv Stickstoff fixieren [32]. Rhizobiale Regulationsmechanismen, die gegenüber O . empfindlich sind2 Spannungen sind essentiell für eine erfolgreiche Differenzierung in Bakteroide und die Etablierung einer produktiven Symbiose [33–35].

Mehrere O2 Sensoren haben sich in Rhizobien entwickelt, von denen drei weit verbreitet sind und oft im selben Organismus koexistieren [11,36]. Das erste ist das membrangebundene FixL-Protein, das mit dem FixJ-Empfängerprotein ein Zweikomponentensystem (TCS) bildet (Übersicht in [37,38]). Unter mikroaeroben Bedingungen phosphoryliert FixL FixJ, was wiederum die Expression des fixK Transkriptionsfaktor [39–41]. FixK induziert die Expression nachgeschalteter Gene, indem es als Dimer an ein „Anaerobox“-Motiv (TTGAT-N4-ATCAA) stromaufwärts ihrer Promotoren [42,43].

Das zweite gemeinsame O2 Sensor ist eine Variante von FixL namens Hybrid FixL (hFixL) [44,45]. Dies bildet ein alternatives TCS mit FxkR als Empfängerprotein. FxkR ist kein FixJ-Homolog, induziert jedoch in ähnlicher Weise die Expression von fixK, durch Bindung an ein vorgeschaltetes „K-Box“-Motiv (GTTACA-N4-GTTACA) [46]. Das dritte O2 Sensor ist der FnrN-Transkriptionsfaktor. Wie FixK bindet FnrN das Anaerobox-Motiv als Dimer und beide sind enge Homologe des E. coli Anaerobioseregulator FNR [47–49]. Im Gegensatz zu FixK, aber wie FNR enthält FnrN einen N-terminalen Cystein-reichen Cluster, der das Protein zu einem direkten Sensor für O . macht2 [50–53]. Es ist bekannt, dass die Sensoren FixL und hFixL bei relativ milden mikroaeroben Bedingungen aktiv werden, einschließlich bei freilebenden Rhizobien [54–56]. FnrN ist wahrscheinlich viel weniger O2 tolerant. Das Ö2 Empfindlichkeit von FnrN wurde nicht bestimmt, aber die E. coli Das FNR-Homolog ist nur unter anaeroben Bedingungen aktiv [57–59]. Alle bisher untersuchten symbiotischen Rhizobien verwenden mindestens einen dieser drei Sensoren [11]. Es ist üblich, dass diese Sensoren nebeneinander existieren, insbesondere in Rhizobium leguminosarum Biovar viciae VF39, mehrere Stämme von Ensifer meliloti (vorher Sinorhizobium meliloti) und Rhizobium etli CFN42 [44,45,60–62].

Weitere Betonung der Bedeutung von O2 Regulierung bei der symbiotischen Stickstofffixierung nutzen Rhizobien auch die O2 Erfassen des NifA-Transkriptionsfaktors, um ihre endgültige Differenzierung in stickstofffixierende Bakteroide zu regulieren (für Übersichten siehe [38,63]). Es wird angenommen, dass die NifA-Sauerstoffempfindlichkeit von einem metallbindenden Cystein-reichen Motiv in einem Interdomänen-Linker des Proteins herrührt [64–66]. Das Protein hat ein großes Regulon, insbesondere enthält es Nitrogenase-Komponenten wie nifH [67–70]. Ausdruck von nifA wird in Rhizobien in der Regel automatisch reguliert, oft über Read-Through von einem vorgeschalteten Gen oder Operon, das NifA-reguliert ist, in vielen Fällen fixABCX [69,71–73]. In Rlv3841, a fixABCX Operon befindet sich direkt vor nifA, was auf einen solchen Read-Through-NifA-Autoaktivierungsmechanismus hindeutet. Normalerweise ist kein Ausdruck von nifA noch wird die Aktivität des Proteins direkt von den drei O2 oben beschriebenen Sensoren [11]. Eine bemerkenswerte Ausnahme ist E. meliloti, wo nifA wird durch das FixLJ-System reguliert [74–76]. Es gibt keine Hinweise darauf, dass FixK oder FnrN direkt regulieren nifA Ausdruck in Rlv3841.

Es scheint ein Spektrum unter Rhizobien zu geben, wobei einige Arten Sauerstoffsensoren in separate Wege aufteilen, während bei anderen Arten diese Sensoren teilweise oder vollständig zu einem kombinierten hierarchischen Weg verschmolzen sind [77,78]. Wenn sich Sauerstoffsensoren in getrennten Pfaden befinden, besteht häufig eine Redundanz. In diesen Situationen hebt der Verlust eines Sauerstoffsensors die Stickstofffixierungsaktivität nicht auf [79,80]. Im Gegensatz dazu sind bei der Zusammenführung von Sensoren zu einem einzigen Regulationsweg einige Komponenten einzeln essentiell [11]. Somit kann der Verlust eines Sauerstoffsensors die Stickstofffixierung stark beeinträchtigen, selbst wenn andere Sensoren verbleiben.

In R. Hülsenfrüchte bv. VF39, das Ausknocken von FnrN oder hFixL, reduzierte die Stickstofffixierung auf 30% bzw. 50% des WT, was auf eine nicht-hierarchische, redundante Anordnung hindeutet [60]. Der hFixL-FxkR-FixK-Weg von R. etli CFN42 ist als Double entbehrlich fixK Mutante hatte keinen Einfluss auf die Stickstofffixierung, während eine doppelte fnrN Mutante reduzierte die Fixierung auf 20% der WT-Spiegel. Im Gegensatz, R. etli CFN42 scheint einen komplexen hierarchischen Weg zu verwenden, wobei mehrere Homologe von FixK und FnrN die Expression des jeweils anderen regulieren [61,62]. Es wurden auch Spezies gefunden, die nur Homologe von hFixL oder FnrN kodieren. Rhizobium leguminosarum Biovar viciae UPM791 enthält zwei FnrN-Homologe, aber weder FixL noch hFixL [81]. Es ist nicht bekannt, ob die beiden FnrN-Proteine ​​auf unterschiedliche O . reagieren2 Konzentrationen oder redundant agieren. E. meliloti 1021 enthält kein FnrN-Homolog, aber ein gut untersuchtes FixLJ-System und scheint Homologe von hFixL und FxkR zu haben [82–84].

Um die Beziehung zwischen hFixL und FnrN zu untersuchen, haben wir den Modellorganismus untersucht Rhizobium leguminosarum Biovar viciae 3841 (Rlv3841), der beide Sensoren verwendet (Abb. 1) [85,86]. Rlv3841 hat ein einzelnes Chromosom, dessen Gennamen mit RL beginnen, und sechs Megaplasmide pRL7-12, deren Gennamen mit z.B. pRL9. Das wichtigste symbiotische Plasmid ist pRL10, aber viele symbiotische Gene finden sich auch auf pRL9, einschließlich einer Kopie des fixNOQP und fixGHIS Operon. Rlv3841 kodiert zwei Kopien von hfixL, die wir genannt haben hfixL9 (pRL90020 auf pRL9) und hfixLC (RL1879 auf dem Chromosom), mit 54,9% Identität auf Proteinebene. Der Stamm enthält auch zwei Homologe (58% Identität) von fxkR, fxkR9 (pRL90026) und fxkRC (RL1881). Es hat drei mutmaßliche fixK Gene, die wir bezeichnet haben fixK9a (pRL90019), fixK9b (pRL90025) und fixKC (RL1880). Die fixK9a und fixK9b Sequenzen haben 53 % Aminosäureidentität, während fixKC teilt 38% bzw. 47% Identität mit diesen Proteinen. Beide fixK9a-hfixL9 und fixKC-hfixLC scheinen Operons zu bilden (Fig. 1B und 1D). Rlv3841 hat eine Kopie von fnrN (RL2818), reguliert durch zwei Anaeroboxen. Eine ähnliche Dual-Anaerobox-Anordnung existiert in Rlv UPM791, wo FnrN seine eigene Expression positiv und negativ autoreguliert [87]. Die Bindung von FnrN an die distale Anaerobox induziert fnrN Transkription und Bindung an die proximale Anaerobox unterdrückt es. Über die automatische Aktivierung von FnrN wurde auch berichtet in Rhizobium etli CNPAF512 [88]. FixK-Regelung von fnrN Expression ist wahrscheinlich, da sie auch Anaeroboxen bindet, dies wurde jedoch nicht untersucht.

Sauerstoff wird in roten Rauten angezeigt. Proteine ​​werden als Ovale, Operatorstellen als Quadrate und Gene als spitze Rechtecke dargestellt. Transkriptionsstartstellen werden als rechtwinklige Pfeile angezeigt. Linienenden zeigen Aktivierung (Pfeile), Hemmung (stumpfes Ende) und Translation (Kreis) an. (EIN) Der von den beiden Sensoren gebildete einzelne Pfad wirkt in zwei Stufen. Stadium I beginnt unter mikroaeroben Bedingungen und kann außerhalb des Knotens funktionieren. In dieser Phase ist hFixL aktiv, FnrN jedoch nicht. hFixL aktiviert FxkR, das an den K-Box-Operator (orangefarbene „K“-Quadrate) bindet, um die Expression von zu induzieren fixK. FixK bindet an Anaerobox-Operatoren (blaue „A“-Quadrate), um die Expression zu induzieren, auch stromaufwärts von fixNOQP (gestrichelte Linie) und fnrN. Sobald der Sauerstoff in den Bakterien nahezu anaerobe Werte erreicht, wird FnrN aktiv und Stadium II beginnt. Wie FixK bindet FnrN Anaeroboxen. Es reguliert sich automatisch fnrN sowohl positiv als auch negativ und induziert fixNOQP Ausdruck. (B) Rlv3841 hat mehrere Kopien mehrerer Sauerstoffregulationsgene und viele sind in Clustern angeordnet. Auf Megaplasmid pRL9, fixK9a bildet ein Operon mit hfixL9, geregelt durch eine K-Box. Dieses Operon grenzt an fixNOQP9, reguliert durch eine Anaerobox. (C) fixK9b und fxkR9 sind benachbart, mit einer Anaerobox und einer K-Box in ihrem intergenischen Bereich. (D) Das Rlv3841-Chromosom hat auch einen Cluster mit fxkRC, fixKC und hfixLC. Im Gegensatz zu ähnlichen Clustern auf pRL9 enthält die intergenische Region dieses Clusters keine Anaerobox- oder K-Box-Operatoren. (E) Die fnrN Gen ist nicht Teil eines Clusters und wird durch eine distale und eine proximale Anaerobox positiv bzw. negativ reguliert. Details zur Transkriptionsstartstelle, Anaerobox und K-Box-Positionen finden Sie in Tabelle 1.

Eine Studie in R. Hülsenfrüchte VF39 fand heraus, dass die mikroaerobe Expression von fnrN erfordert auch RpoN [89]. Dieses Ergebnis wurde an anderer Stelle nicht repliziert, und seine Bedeutung bleibt unklar. In ... Arbeiten R. etli CNPAF512 hat gezeigt, dass fnrN wird in diesem Organismus nicht durch RpoN kontrolliert [88]. Rlv3841 kodiert einen mutmaßlichen rpoN Gen (RL0422), aber wir fanden keine RpoN-Bindungsstellen stromaufwärts von Rlv3841 fnrN Transkriptionsstartseite. RpoN scheint daher nicht erforderlich für fnrN Ausdruck in Rlv3841.

Eine parallele Anordnung von hFixL-FxkR-FixK und FnrN in Rlv3841 würde Redundanz erzeugen, während eine Reihenanordnung eine Hierarchie zwischen den beiden Reglern schaffen würde. Unser Ziel ist es daher zu verstehen, wie die beiden Sensoren in Rlv3841 interagieren und einen Einblick in ihre Koexistenz zu geben.


Abstrakt

Mikrobenverderb und lebensmittelbedingte Krankheiten verursachen erhebliche wirtschaftliche und Produktivitätsverluste. Es besteht Bedarf an neuen Ansätzen und antimikrobiellen Behandlungen, um die Haltbarkeit von Produkten zu verlängern, die Qualität und die mikrobielle Sicherheit zu verbessern und Verderb und Abfall zu reduzieren, sowie neue Bewertungsmethoden. Herkömmliche Assays zum Testen der Toxizität von antimikrobiellen Mitteln sind zeitaufwendig, arbeitsintensiv, geben grobe Schätzungen der Toxizität und können keine komplexen Proben wie rohe Lebensmittelhomogenate analysieren. Unter Verwendung einer antimikrobiellen Modellverbindung Lauroyl Arginate Ethyl Ester (LAE) beschreiben wir eine neue analytische Methodik basierend auf optischer Sauerstoffsensorik und Respirometrie, um die Auswirkungen verschiedener antimikrobieller Behandlungen auf reine Bakterienkulturen, Fleischmikrobiota und verpackte Fleischproben zu untersuchen. Durch Messung und Analyse der Zeitprofile von O2 Sondensignal (Phosphoreszenzlebensdauer) in inkubierten Testproben konnten wir die toxischen Wirkungen von LAE auf die verschiedenen Bakterienarten visualisieren, Zeit- und Dosis-Wirkungs-Kurven erstellen, EC50 und Generationszeiten von Testorganismen berechnen. Die neue multiparametrische Toxizitätstestplattform ermöglicht eine schnelle, automatisierte und parallele Analyse mehrerer Proben unter einer Reihe von antimikrobiellen Konzentrationen und Bedingungen.


Design und Entwicklung von E. coli-Stoffwechselsensorstämmen mit einem breiten Empfindlichkeitsbereich für Glycerat

Mikrobielle Biosensoren werden verwendet, um das Vorhandensein von Verbindungen zu detektieren, die extern bereitgestellt oder intern produziert werden. Der letztere Fall wird im Allgemeinen durch die Notwendigkeit eingeschränkt, eine große Bibliothek von Enzym- oder Stoffwechselwegvarianten zu durchmustern, um diejenigen zu identifizieren, die die gewünschte Verbindung effizient erzeugen können. Um dieser Einschränkung zu begegnen, schlagen wir die Verwendung von metabolischen Sensorstämmen vor, die nur wachsen können, wenn die relevante Verbindung vorhanden ist, und so das Screening durch direkte Selektion ersetzen. Wir haben eine Computerplattform verwendet, um metabolische Sensorstämme mit unterschiedlichen Abhängigkeiten von einer bestimmten Verbindung zu entwerfen. Unsere Methode untersucht systematisch Kombinationen von Gendeletionen und identifiziert, wie sich der Wachstumsbedarf für eine Verbindung mit der Medienzusammensetzung ändert. Wir demonstrieren diesen Ansatz, indem wir eine Reihe von E. coli-Glycerat-Sensorstämmen konstruieren. In jedem dieser Stämme wird ein anderer Satz von Enzymen zerstört, so dass der zentrale Stoffwechsel effektiv in mehrere Segmente zerlegt wird, von denen jedes eine dedizierte Kohlenstoffquelle benötigt. Wir finden eine fast perfekte Übereinstimmung zwischen der vorhergesagten und der experimentellen Abhängigkeit von Glycerat und zeigen, dass die Stämme verwendet werden können, um Glyceratkonzentrationen über zwei Größenordnungen hinweg genau zu bestimmen. Neben der Demonstration der potentiellen Anwendung metabolischer Sensorstämme zeigen unsere Arbeiten Schlüsselphänomene im zentralen Stoffwechsel auf, darunter den spontanen Abbau zentraler Metaboliten und die Bedeutung von Stoffwechselsenken für den Ausgleich kleiner Stoffwechselnetzwerke.

Schlüsselwörter: Auxotrophie Beschränkungsbasiertes Stoffwechselmodell Wachstumsselektion Synthetische Biologie.

Copyright © 2019 Die Autoren. Herausgegeben von Elsevier Inc. Alle Rechte vorbehalten.


Reaktortechnik

13.4.8 Programmierte Steuerung

Aufgrund des inhärenten zeitvariablen Charakters von Batch- und Fed-Batch-Fermentationen ist die Aufrechterhaltung einer konstanten Umgebung oder konstanter Werte von Stoffwechselvariablen nicht immer die optimale Steuerungsstrategie. Je nach Prozess können Änderungen von Variablen wie pH und Temperatur zu kritischen Zeiten die Produktionsrate und die Ausbeute verbessern. Die Variation der Futtermenge ist bei der Fed-Batch-Bäckerhefefermentation wichtig, um den Crabtree-Effekt zu minimieren und die Biomasseproduktion zu maximieren. Vorschubgeschwindigkeit wird auch in . manipuliert E coli Fermentationen zur Reduzierung der Nebenproduktsynthese. Bei Sekundärmetaboliten-Fermentationen sollte die spezifische Wachstumsrate zu Beginn der Kultur hoch sein, aber bei hohen Zelldichten sind andere Bedingungen erforderlich, um das Wachstum zu verlangsamen und die Produktbildung zu stimulieren. Ähnliche Strategien werden benötigt, um die Proteinsynthese aus rekombinanten Organismen zu optimieren. Die Expression von rekombinantem Produkt wird normalerweise zu Beginn der Kultur vermieden, da das Zellwachstum beeinträchtigt wird, später wird jedoch im Ansatz ein Induktor hinzugefügt, um die Proteinsynthese anzuschalten.

Für viele Bioprozesse ist eine bestimmte zeitliche Abfolge von pH, Temperatur, gelöstem Sauerstoff, Zufuhrgeschwindigkeit und anderen Variablen erforderlich, um die Kultur so zu entwickeln, dass die Produktivität maximiert wird. Eine Kontrollstrategie, die weitreichende Änderungen der Fermentationsvariablen berücksichtigen kann, ist programmierte Steuerung, auch bekannt als Batch-Fermenter-Planung. Bei der programmierten Steuerung besteht die Kontrollrichtlinie aus einem Zeitplan von Kontrollfunktionen, die zu verschiedenen Zeitpunkten während des Prozesses implementiert werden. Diese Art der Steuerung erfordert ein detailliertes Verständnis der Anforderungen des Prozesses in verschiedenen Phasen und ein einigermaßen vollständiges und genaues mathematisches Modell des Systems.


MATERIALEN UND METHODEN

Materialien

Mycobacterium tuberculosis Die genomische H37Rv-DNA wurde von Dr. Jeffery Cox von der University of California, San Francisco, erhalten. Ampicillin wurde von Fisher Biotech bezogen, während Chloramphenicol von Roche, Hämin von Fluka Biochemica, Dithionit von JT Baker und IPTG von Promega bezogen wurde. Lysozym und Phenylmethylsulfonylfluorid stammten von Sigma. Protease-Inhibitoren (Antipain, Leupeptin und Pepstatin), Chloramphenicol, Fast Start High Fidelity PCR-System und Amplitaq Polymerase wurden von Roche bezogen. Eine DNA-Leiter mit 1 kb plus wurde von Life technologies gekauft. Argon und CO stammten von Matheson Tri-Gas.

Simply Blue Safe Stain, In Vision Histag In-Gel Stain, Siehe Blue Plus 2 Proteinmarker, S.O.C. Medium, zusammen mit der Gelapparatur (Novex MiniCell), wurden NuPage 12% Bis-Tris-Gele und NuPage MOPS SDS-Laufpuffer von Invitrogen gekauft. Die E coli XL-10 Gold-, BL21DE3- und XL-1 Blue-Zellen stammten von Stratagene.

Der TOPO TA Klonierungskit wurde von Invitrogen und der QuikChange Mutagenesis Kit von Stratagene bezogen. Die DNA-Reinigung wurde unter Verwendung von QIAgen-Kits durchgeführt. Die Restriktionsenzyme, T4-DNA-Ligase und alkalische Phosphatase stammten von New England Biolabs. HisTrap TM HP-Säulen wurden von GE Healthcare bezogen, während Dialyseschläuche von Spectrum Laboratory, Inc. bezogen wurden.

Das pET23a+-Plasmid wurde von Novagen bezogen. Das pTGroE-Plasmid wurde freundlicherweise von Dr. Shunsuke Ishii vom Laboratory of Molecular Genetics, Riken Tsukuba Life Science Center, Japan, bereitgestellt.

Die Primer wurden unter Verwendung des GCG-Softwarepakets Version 10.3 für UNIX von der University of Wisconsin entworfen. Kundenspezifische Primer wurden von Invitrogen synthetisiert. Aminosäureanalysen wurden an der University of California, Davis, durchgeführt. DNA-Proben wurden an der University of California, Berkeley, sequenziert.

Klonen des DevS-Gens in voller Länge

Das DevS-Gen wurde amplifiziert aus Mycobacterium tuberculosis H37Rv genomische DNA mit einem PCR PTC-200 Peltier Thermal Cycler von MJ Research und dem Fast Start High Fidelity PCR System von Roche. Ein 10 Min. Auf die anfängliche Denaturierung bei 94 ଌ folgten 35 Zyklen: 94 ଌ 1 min, 45 ଌ 1,5 min, 72 ଌ 3 min und eine 10 min letzte Verlängerung bei 72 ଌ. Der Vorwärtsprimer (GGATAGGGCATATGACAACAGGGGGCCTC) enthielt eine NdeI-Schnittstelle, während der reverse Primer (CCAAACGGGGATCCGAAGAGCTACTGCGACAAC) a BamH1 Website. Die Reaktionsmischung enthielt 4% DMSO. Das bei dieser Reaktion erhaltene Produkt wurde unter Verwendung der gleichen Bedingungen erneut amplifiziert, um ausreichende Mengen an PCR-Produkt zu erhalten.

TOPO TA Klonen

3’ Poly-Adenin-Überhänge wurden dem gereinigten PCR-Produkt mit Amplitaq DNA-Polymerase hinzugefügt. Die TOPO-TA-Klonierungsreaktion wurde 30 Minuten bei Raumtemperatur gemäß den Anweisungen des Herstellers unter Verwendung des pCR2.1-TOPO-Vektors durchgeführt. Plasmid-DNA wurde aus mehreren Kolonien von TOP10-Zellen gereinigt, die mit dem TOPO TA-Klonierungsreaktionsprodukt transformiert waren. Die Insertion des DevS-Gens wurde mittels Restriktionsverdaus (entweder Ncoich oder NichtI) und die korrekte Sequenz des DevS-Gens wurde durch DNA-Sequenzierung bestätigt.

Subklonen von DevS642

Die ersten 642 bp, die für die N-terminale GAF-Domäne kodieren, wurden unter Verwendung der gleichen PCR-Bedingungen und der folgenden Primer amplifiziert: CCGCCGCCATATGCATCATCATCATCATCACGAGAACTTATATTTTCAAGGAATGACAACAGGGGGCCTCGTCGAC (Vorwärtsprimer mit einem 6-His-Tag und einem NdeI-Schnittstelle) und CGGACAAGCTCTATTACGACTGACCGGCCTTAGCCTGCTG (der reverse Primer, der a HindIII-Seite). Das gereinigte PCR-Produkt wurde mit verdaut NdeIch und HindIII und ligiert in pET23a+, gespalten mit den gleichen Restriktionsenzymen sowie mit alkalischer Phosphatase. Ultrakompetente XL-10 Gold-Zellen wurden mit dem Ligationsprodukt transformiert. Nach der Restriktionsanalyse wurde auch die Plasmid-DNA einer Sequenzierung unterzogen, um die korrekte Sequenz zu bestätigen.

Mutagenese von His149 von DevS642

Das QuikChange Mutagenesis Kit von Stratagene wurde verwendet, um His149 gemäß den Anweisungen des Herstellers zu einem Alanin zu mutieren. Die verwendeten mutagenen Primer waren: CGATTGGTTTTCCGCCGTATGCCCCGCCGATGCGTACCTTCCT (Vorwärtsprimer) AGGAAGGTACGCATCGGCGGGGCATACGGCGGAAAACCATCG (Rückwärtsprimer). Die Konstrukte wurden einer DNA-Sequenzierung unterzogen, um die korrekte Sequenz zu bestätigen.

Ausdruck von DevS642 und DevS in voller Länge

BL21gold DE3-Zellen wurden mit pET23a+DevS642 und pT-GroE co-transformiert. Die Zellen wurden auf LB-Platten gezüchtet, die sowohl Ampicillin (50 µg/ml) als auch Chloramphenicol (34 µg/ml) enthielten. Fünf Starterkulturen wurden dann mit jeweils einer Kolonie beimpft. Die fünf Kulturen wurden dann gepoolt und zum Animpfen von Kolben verwendet, die 1,5 l LB-Medium sowie die Antibiotika Ampicillin (100 μg/ml) und Chloramphenicol (34 μg/ml) enthielten. Die Zellen wurden bis zu einer optischen Dichte von OD600 0,8 bei 37 °C und 230 U/min gezüchtet. Hämin wurde vor der Induktion zugegeben (45 mg/4,5 ml NaOH 0,1 N für jede 1,5 l Kultur). Die Proteinexpression wurde mit IPTG bei einer Endkonzentration von 1 mM induziert und die Kolben wurden 20 h bei 18 °C gehalten. Die Zellen wurden durch 25-minütige Zentrifugation bei 5000 U/min geerntet. Außerdem E coli BL21DE3 wurden zwei weitere Zelllinien getestet: Rosetta 2 und DH5α. DH5α-Zellen exprimierten das gewünschte Protein nicht, wenn sie nur mit dem für DevS642 kodierenden Plasmid transformiert wurden oder wenn sie cotransformiert wurden, um auch den GroEL/ES-Komplex bereitzustellen. Rosetta-2-Zellen wurden ebenfalls getestet, da mehrere Codons mit geringerer Verwendung in E coli wurden innerhalb des Gens identifiziert. Es wurde jedoch festgestellt, dass das Expressionsniveau nicht signifikant erhöht war. Das DevS voller Länge wurde in pET23a+ kloniert, wobei die gleiche Strategie wie im Fall des wt DevS642-Proteins verwendet wurde. Das DevS voller Länge wurde mit dem GroEL/ES-Komplex co-exprimiert und dann unter den gleichen Bedingungen gereinigt.

Ausdruck von ApoDevS642

Es wurde das gleiche Verfahren wie für das Häm-gebundene Protein befolgt, außer dass i) kein Hämin zugegeben wurde und ii) zusätzliche Schritte unternommen wurden, um Eisen und Kobalt aus dem Kulturmedium zu entfernen. Ein veröffentlichtes Verfahren wurde verwendet und modifiziert, um Kobaltsalze aus der Mineralmischung auszuschließen (23).

Expression der H149A-Mutante von DevS642

Die Mutante konnte sowohl als Häm-gebundenes Protein als auch als Apoprotein nach dem im Fall von wt DevS642 verwendeten Verfahren exprimiert werden. Um das Apoprotein zu erhalten, war die fehlende Hämin-Zugabe ausreichend und es waren keine weiteren Schritte erforderlich, um die Kontamination mit dem Häm-gebundenen rekombinanten Protein zu verringern. Das Apoprotein der H149A-Mutante wurde unter Verwendung von LB-Medium erhalten.

Proteinreinigung

Die Zellen wurden in Phosphatpuffer pH 7,6 (50 mM NaH&sub2;2Bestellung4, 10 % Glycerin, 200 mM NaCl, 1 % Triton X-100, 0,5 mg/ml Lysozym, Proteasehemmer: Antipain 1 μg/ml, Leupeptin 1 μM, Pepstatin 1 μM, PMSF 0,1 mM). Dann wurde die Mischung unter Schütteln bei 37 °C für 10 min inkubiert. Die Zellmembranen wurden durch wiederholte Beschallungszyklen bei 50% unter Verwendung eines Branson Beschallers 450 von VWR Scientific unter Eiskühlung aufgebrochen. Die unlösliche Fraktion wurde durch Zentrifugation bei 35000 U/min für 1 h bei 4 °C isoliert. Das Zelllysat wurde mit einer Geschwindigkeit von 1 ml/min auf eine 5-ml-His-Trap-Säule aufgetragen. Die Säule wurde dann mit 20 und 50 mM Imidazol in Phosphatpuffer (50 mM NaH&sub2;2Bestellung4, 10 % Glycerin, 500 mM NaCl, 50 ml bei einer Geschwindigkeit von 2 ml/min). Das rekombinante Protein eluierte mit 200 mM Imidazol in Phosphatpuffer (50 ml, 1 ml/min). Die Probe wurde dann dialysiert und die Fraktionen, die nicht rein waren, wurden auf einer His-Trap-Säule erneut gereinigt, um das reine Protein bereitzustellen. Dieses Verfahren war erfolgreich für das Häm, das wt DevS642 und H149A enthält, und auch für das Apoprotein der H149A-Mutante. Der Puffer wurde zur Isolierung von apoDevS642 durch 20 mM Hepes-Puffer (150 mM NaCl pH 8) ersetzt.

Proteinquantifizierung

Der Proteingehalt für das wt DevS642 wurde durch Aminosäureanalyse an der University of California, Davis bestimmt. Die Ausbeute an löslichem Protein betrug 16 mg/L Kultur bei Co-Expression mit den Hitzeschockproteinen GroEL/ES. Die Ausbeute an löslichem Protein, wenn es ohne Chaperone exprimiert wurde, betrug 2,3 mg/l Kultur.

Bestimmung des Häm-Gehalts von Wt DevS642

Natriumhydroxid 5 N (5 μL) und Pyridin (18 μL) wurden zu der Proteinprobe (80 μL des Eisen(III)-Komplexes) gegeben. Das oxidierte Spektrum wurde aufgezeichnet und dann wurde Natriumdithionit (einige Kristalle) zugegeben, um das reduzierte Spektrum zu erhalten. Die Extinktion bei 539 und 556 nm wurde verwendet, um den Häm-Gehalt gemäß dem veröffentlichten Protokoll zu bestimmen (24). Der Hämgehalt wurde zu 97% bestimmt.

Größenausschlusschromatographie von Wt DevS642

Der oligomere Zustand des rekombinanten Proteins DevS642 wurde unter Verwendung einer Superdex 75 (FPLC) Säule in einem Phosphatpuffersystem (50 mM Phosphat, 200 mM NaCl pH 7,6) ermittelt. Die Extinktion des Eluats wurde bei zwei Wellenlängen, 280 und 406 nm, überwacht. Dextran (1 mg/ml) wurde verwendet, um das Hohlraumvolumen zu bestimmen. Die Kalibrierkurve wurde mit folgenden Proteinstandards erstellt: Albumin (MG 66000, 10 mg/mL), Alkoholdehydrogenase (MG 150000, 5 mg/mL), Carboanhydrase (MG 29000, 3 mg/mL), Cytochrom c (MG 12400, 2 mg/ml). DevS642 ist zu 96 % monomer (MG 30269, geschätzt aus dem Gelfiltrationsassay) und 4 % dimer (MG 61518).

Hämintitrationen von Wt ApoDevS642

Eine 500 µl Proteinprobe (typischerweise 5 µM Konzentration in Hepes 20 mM, NaCl 150 mM, 10 % Glycerinpuffer) wurde mit einer Häminlösung titriert. Aliquots von 0,5 μL einer 0,106 mg/ml Häminlösung wurden zugegeben und das Differenzspektrum wurde 10 Minuten nach jeder Zugabe aufgezeichnet (die Referenzküvette enthielt Puffer und die gleichen Mengen an Hämin.) Um die Dissoziationskonstante zu erhalten, 𹒫sorption 407-350 nm wurde als Funktion der Häminkonzentration aufgetragen und die Datenpunkte in der Titration wurden an die folgende Gleichung angepasst: 𹒫sorption = Amax/1 + KD/[Hämin] (25).

Cyanid- und Azid-Titrationen von Wt DevS642

The concentration of DevS642 was determined based on the intensity of the Soret peak at 407 nm. A 500 μL sample (usual concentration 5 μM) was used in these assays. The initial spectrum of the protein in phosphate buffer (50 mM phosphate and 200 mM sodium chloride) was recorded and then difference spectra were acquired 5 min. after each addition (typically 0.5 μL) of the ligand to both the reference cuvette and the cuvette containing the protein solution. Sodium azide and potassium cyanide were prepared as aqueous solutions in the same buffer. The increase in absorbance at 424 nm (cyanide) or 422 (azide) was plotted as a function of ligand concentration and the data were fit to a rectangular hyperbola (the azide titration) or the quadratic tight binding equation in the case of cyanide (26).

Electronic Absorption and Resonance Raman Spectroscopy

Typical enzyme concentrations used were

100� μM. Biomax-10 ultrafiltration devices (Millipore) were used for buffer exchange and for concentrating the protein. Reduction to the ferrous state was achieved by adding microliter aliquots of 25� mM sodium dithionite solution to an argon-purged sample in the Raman capillary cell and was monitored by UV-visible spectroscopy directly in the capillary using a Cary 50 spectrometer. 12 CO (Airgas) and 13 CO (99% 13 C, ICON Stable Isotopes) adducts were obtained by injecting CO through a septum-sealed capillary containing argon-purged, reduced protein (

20 μL). Ö2 (Airgas), 18 O2 (99% 18 O, ICON Stable Isotopes), NO (Aldrich), and 15 N 18 O (98% 15 N and 95% 18 O, Aldrich) adducts were generated using the same procedure after excess dithionite was removed from the reduced sample with desalting spin columns (Zebra ™ 0.5 mL, Pierce). These procedures were performed in a glovebox with a controlled atmosphere of less than 1-ppm of O2 (Omni-Lab System, Vacuum Atmospheres Company). RR spectra were obtained using a custom McPherson 2061/207 spectrograph (0.67 m with variable gratings) equipped with a Princeton Instruments liquid N2-cooled CCD detector (LN-1100PB). Kaiser Optical supernotch filters were used to attenuate Raleigh scattering. A Krypton laser (Innova 302, Coherent) and a He/Cd laser (Liconix 4240NB) were used for the 413- and 442-nm excitations, respectively. Spectra were collected in a 90° scattering geometry on samples at room temperature. Frequencies were calibrated relative to indene and CCl4 and are accurate at ଑ cm 𢄡 . CCl4 was also used to check the polarization conditions. The integrity of the RR samples, before and after laser illumination, was confirmed by direct monitoring of their UV-visible spectra in the Raman capillaries.


Abschluss

Complications in E coli-related infection have been mainly attributed to biofilm formation. Biofilm is considerably recalcitrant to antibiotics as compared to its planktonic culture. Escherichia coli biofilm formation is an intricate process which involves a number of steps such as initial adhesion, early development, maturation and dispersion. These steps are governed by a number of genes that serve specific functions in the formation of the biofilm. Type I fimbriae of E coli plays a crucial role in its attachment to the surface and maturation is further facilitated by autotransporters and EPS. Recent discoveries have also identified stress resistance genes in the biofilm-formation process that help the biofilm to survive in hostile environments. Die rpoS gene is majorly responsible for regulating genes and structural proteins involved in the synthesis and degradation of biofilm, under stress conditions.

Escherichia coli biofilm has been found to be resistant to a number of antibiotics, mostly accredited to putative multidrug resistance pump. The development of the extracellular matrix and the observed increased resistance to common antibiotics create a challenge to control the infections caused by E coli biofilms. Recently there have been advances in exploring and developing new approaches and therapeutic methods to cure E coli biofilm-related infections.

Molecular and structural understanding of E coli biofilm has led to the advances in targeting specific agents to curtail infections. Type I pili of E coli are crucial for the adhesion and initiation of E coli Biofilmbildung. The curlicides and pilicides have been designed against curli subunit protein CsgA and type I pili, respectively, and have been shown to inihibit bacterial biofilm. The combination of phages have shown to complement lysis of bacteria through different mechanism of action and yielded promising results. Bacterial biofilm has been notorious in mounting resistance and phytochemicals and AMPs are able to address this issue through their diverse mechanism to target organisms.

One of the major problems faced by these remedial agents is stability and low bioavailability. Natural compound efficacy can be improved by incorporating them in nanoparticles or coating on a particular surface. Silver nanoparticles have shown great promise especially in coating the medical devices and wound dressings and were found to be effective against E coli biofilm both in vitro und in vivo mouse model. An antimicrobial nanospray JUC, which was sprayed on a catheter was found to be efficacious in restricting E coli Biofilmbildung. These new methods hold a great promise but the issues concerning in vivo efficacy, toxicity and large-scale production need to be addressed before these potential therapeuticals can reach the clinical stage.


Danksagung

We acknowledge funding by the Bundesministerium für Wirtschaft und Technologie within the framework of Zentrales Innovationsprogramm Mittelstand (ZIM). We also wish to thank Steffen Wagner and Stefan Ortleb for excellent technical assistance.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the Neuer Phytologe Central Office.

Fig. S1 The influence of PFD immersion on the photosynthetic output of a sycamore leaf.

Fig. S2 The effect of the photosynthesis inhibitor DCMU on light-dependent oxygen production in the sycamore leaf.

Bitte beachten Sie: Der Herausgeber ist nicht verantwortlich für den Inhalt oder die Funktionalität der von den Autoren bereitgestellten unterstützenden Informationen. Alle Anfragen (außer fehlenden Inhalten) sollten an den entsprechenden Autor des Artikels gerichtet werden.


Schau das Video: Mayo Clinic Minute: E. coli Fast Facts (September 2022).


Bemerkungen:

  1. Odi

    Sie liegen falsch. Ich bin sicher. Ich schlage vor, darüber zu diskutieren. Schreiben Sie mir in PM.

  2. Wajih

    Hat eine Seite mit einem Thema gefunden, das Sie interessant hat.

  3. Gouveniail

    Ich bestätige. Und damit bin ich gestoßen. Wir werden diese Frage diskutieren.

  4. Garran

    Eine ausgezeichnete und zeitnahe Reaktion.

  5. Gabi

    Bravo, diese sehr gute Idee wird nützlich sein.

  6. Leeland

    Ich glaube, dass du falsch liegst. Lassen Sie uns dies diskutieren. Senden Sie mir eine E -Mail an PM, wir werden reden.



Eine Nachricht schreiben