Information

Werden Genmutationen zu einem Protein führen, das kürzer ist als das Protein in voller Länge?

Werden Genmutationen zu einem Protein führen, das kürzer ist als das Protein in voller Länge?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Welche Beziehung besteht zwischen der Deletion oder Insertion eines Nukleotids in der Gensequenz und der Länge des Proteins, das aus dem mutierten Gen heraus kodiert wird?


Es hängt von der Art der Einfügung oder Löschung ab.

Viele Mutationen sind Punkt Mutationen, bei denen ein einzelnes Nukleotid verändert wird:

ATGACTACGCTATTCAGT M T T L F S ATGTCTACGCTATTCAGT M S T L F S

Beachten Sie, dass die Änderung des vierten A zu einem T eine T->S-Änderung im endgültigen Protein verursachte und seine Länge nicht änderte. Ein Einfügen/Löschen ist jedoch anders. Beginnend mit dieser Sequenz:

ATGTCTATTGACGCTATTCAG M S I D A I Q

Lassen Sie uns eine Einfügung machen, ein A nach dem A in Position 7:

ATGTCTAATTGACGCTATTCAG M S N STOP

Beachten Sie, dass wir jetzt ein Stopcodon (TGA) haben. Dies bedeutet, dass das Protein abgeschnitten wird und viel kleiner ist. Das ist nicht immer der Fall. Anstatt ein A an Position 7 hinzuzufügen, fügen wir es nach Position 9 hinzu:

ATGTCTATTAGACGCTATTCA M S I R R Y S

Das Protein ist ungefähr gleich lang, aber die AAs unterscheiden sich nach dem Einfügen komplett von der Originalversion:

M S I D A I Q M S I R R Y S

Dies wird als Frameshift-Mutation bezeichnet. Biologisch sind diese Mutationen schädlich, da sie alle Aminosäuren nach der Mutation verändern, das Protein oft nicht funktionsfähig ist und unterschiedliche Größen haben kann (wenn ein Stopcodon jetzt im Frame oder außerhalb des Frames liegt) und das Protein kann sogar enden als instabil und schnell abgebaut.

Um Ihre Frage zur Länge des Proteins zu beantworten, wird es jedes Mal, wenn 3 Nukleotide hinzugefügt/entfernt werden, um eine AA erhöht/verringert, kann sich jedoch erhöhen oder verringern drastisch wenn ein Stopcodon durch eine Frameshift-Mutation hinzugefügt oder entfernt wird.


Starker Zusammenhang zwischen Pseudogenisierungsmechanismen und Gensequenzlänge

Pseudogene entstehen aus dem Zerfall von Genkopien nach entweder RNA-vermittelter Duplikation (prozessierte Pseudogene) oder DNA-vermittelter Duplikation (nicht prozessierte Pseudogene). Hier zeigen wir, dass lange Protein-kodierende Gene dazu neigen, mehr nicht prozessierte Pseudogene zu produzieren als kurze Gene, während das Gegenteil für prozessierte Pseudogene der Fall ist. Protein-kodierende Gene, die länger als 3000 bp sind, produzieren mit 6-mal höherer Wahrscheinlichkeit nicht-prozessierte Pseudogene als prozessierte.

Gutachter

Dieser Artikel wurde von Dr. Dan Graur und Dr. Craig Nelson (nominiert von Dr. J Peter Gogarten) begutachtet.


Abstrakt

Die Liste genetischer Erkrankungen, die durch Mutationen verursacht werden, die die mRNA-Translation beeinflussen, wächst schnell. Obwohl die Proteinsynthese ein grundlegender Prozess in allen Zellen ist, zeigen die Krankheitsphänotypen einen überraschenden Grad an Heterogenität. Studien zu einigen dieser Krankheiten haben faszinierende neue Einblicke in die Funktionen von Proteinen geliefert, die am Prozess der Translation beteiligt sind. Angesichts der zahlreichen Proteine, die an der mRNA-Translation beteiligt sind, ist es wahrscheinlich, dass weitere Erbkrankheiten durch Mutationen in Genen verursacht werden, die an diesem komplexen Prozess beteiligt sind.


Verweise

Taylor, J. P., Hardy, J. & Fischbeck, K. H. Toxische Proteine ​​bei neurodegenerativen Erkrankungen. Wissenschaft 296, 1991–1995 (2002).

Bates, G. Huntingtin-Aggregation und Toxizität bei der Huntington-Krankheit. Lanzette 361, 1642–1644 (2003).

Caughey, B. & Lansbury, P.T. Protofibrillen, Poren, Fibrillen und Neurodegeneration: Trennung der verantwortlichen Proteinaggregate von den unschuldigen Umstehenden. Annu. Rev. Neurosci. 26, 267–298 (2003).

Berke, S. J. & Paulson, H. L. Protein Aggregation and the Ubiquitin Proteasom Pathway: Gewinnung der Oberhand bei der Neurodegeneration. Curr. Meinung. Genet. Abw. 13, 253–261 (2003).

Ross, C. A. & Pickart, C. Der Ubiquitin-Proteasom-Weg bei Parkinson und anderen neurodegenerativen Erkrankungen. Trends Zellbiol. (2004).

Nussbaum, R. L. & Ellis, C. E. Alzheimer-Krankheit und Parkinson-Krankheit. N. Engl. J. Med. 348, 1356–1364 (2003).

Wong, P. C., Cai, H., Borchelt, D. R. &Preis, D.L. Gentechnisch hergestellte Mausmodelle neurodegenerativer Erkrankungen. Nat. Neurosci. 5, 633–639 (2002).

Ross, C. A. Wenn mehr weniger ist: Pathogenese von Glutamin-repetitiven neurodegenerativen Erkrankungen. Neuron 15, 493–496 (1995).

Selkoe, D. J. Proteine ​​auf fatale Weise falten. Natur 426, 900–904 (2003).

Davies, S. W. et al. Die Bildung neuronaler intranukleärer Einschlüsse liegt der neurologischen Dysfunktion bei Mäusen zugrunde, die für die Huntington-Mutation transgen sind. Zelle 90, 537–548 (1997).

Scherzinger, E. et al. Selbstorganisation von polyglutaminhaltigen Huntingtin-Fragmenten zu Amyloid-ähnlichen Fibrillen: Implikationen für die Pathologie der Huntington-Krankheit. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 96, 4604–4609 (1999).

Vonsattel, J. P. et al. Neuropathologische Klassifikation der Huntington-Krankheit. J. Neuropathol. Erw. Neurol. 44, 559–577 (1985).

Kuemmerle, S. et al. Huntington-Aggregate können den neuronalen Tod bei der Huntington-Krankheit nicht vorhersagen. Ann. Neurol. 46, 842–849 (1999).

Gutekunst, C.A. et al. Nukleare und Neuropil-Aggregate bei der Huntington-Krankheit: Beziehung zur Neuropathologie. J. Neurosci. 19, 2522–2534 (1999).

Becher, M. W. et al. Intranukleäre neuronale Einschlüsse bei der Huntington-Krankheit und dentatorubralen und pallidoluysischen Atrophie: Korrelation zwischen der Dichte der Einschlüsse und der Wiederholungslänge des IT15-CAG-Tripletts. Neurobiol. Dis. 4, 387–397 (1998).

Myers, R. H. et al. Klinische und neuropathologische Bewertung des Schweregrades bei der Huntington-Krankheit. Neurologie 38, 341–347 (1988).

Venkatraman, P., Wetzel, R., Tanaka, M., Nukina, N. & Goldberg, A. L. Eukaryotische Proteasomen können Polyglutaminsequenzen nicht verdauen und sie während des Abbaus von Polyglutamin enthaltenden Proteinen freisetzen. Mol.-Nr. Zelle 14, 95–104 (2004).

Huang, C. C. et al. Amyloidbildung durch mutiertes Huntingtin: Schwelle, Progressivität und Rekrutierung von normalen Polyglutaminproteinen. Somat. Zelle Mol. Genet. 24, 217–233 (1998).

Kazantsev, A., Preisinger, E., Dranovsky, A., Goldgaber, D. &. Housman, D. Unlösliche Detergens-resistente Aggregate bilden sich zwischen pathologischen und nicht-pathologischen Längen von Polyglutamin in Säugerzellen. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 96, 11404–11409 (1999).

Margolis, R. L. & Ross, C. A. Expansionsexplosion: Neue Hinweise auf die Pathogenese neurodegenerativer Erkrankungen mit wiederholter Expansion. Trends Mol. Med. 7, 479–482 (2001).

Orr, H. T. & Zoghbi, H. Y. SCA1-Molekulargenetik: eine Geschichte einer 13-jährigen Zusammenarbeit gegen Glutamin. Summen. Mol.-Nr. Genet. 10, 2307–2311 (2001).

Sen, S., Dash, D., Pasha, S. & Brahmachari, S.K. Rolle der Histidin-Unterbrechung bei der Abschwächung der pathologischen Wirkungen langer Polyglutamin-Strecken bei SCA1: ein molekularer Ansatz. Protein Sci. 12, 953–962 (2003).

Selkoe, D. J. Die Alzheimer-Krankheit ist ein synaptisches Versagen. Wissenschaft 298, 789–791 (2002).

Hardy, J. &. Selkoe, D.J. Die Amyloid-Hypothese der Alzheimer-Krankheit: Fortschritte und Probleme auf dem Weg zum Therapeutikum. Wissenschaft 297, 353–356 (2002).

Serpell, L. C. & Smith, J. M. Direkte Visualisierung der β-Faltblattstruktur von synthetischem Alzheimer-Amyloid. J.Mol. Biol. 299, 225–231 (2000).

Esler, W. P. & Wolfe, M. S. Ein Porträt der Alzheimer-Sekretasen – neue Features und bekannte Gesichter. Wissenschaft 293, 1449–1454 (2001).

Citron, M. Alzheimer-Krankheit: Behandlungen in der Entdeckung und Entwicklung. Nat. Neurosci. 5 (Ergänzung), 1055–1057 (2002).

Goedert, M. Tau-Protein und Neurodegeneration. Semin. Zell-Entw. Biol. 15, 45–49 (2004).

Ingram, E. M. &. Spillantini, M. G. Tau-Genmutationen: Sezieren der Pathogenese von FTDP-17. Trends Mol. Med. 8, 555–562 (2002).

Forno, L. S. Neuropathologie der Parkinson-Krankheit. J. Neuropathol. Erw. Neurol. 55, 259–272 (1996).

Dawson, T. M. & Dawson, V. L. Seltene genetische Mutationen geben Aufschluss über die Pathogenese der Parkinson-Krankheit. J. Clin. Investieren 111, 145–151 (2003).

Valente, E. M. et al. Erbliche früh einsetzende Parkinson-Krankheit, die durch Mutationen in PINK1 verursacht wird. Wissenschaft 304, 1158–1160 (2004).

Cleveland, D. W. & Rothstein, J.D. Von Charcot zu Lou Gehrig: Entschlüsselung des selektiven Todes von Motoneuronen bei ALS. Nat. Rev. Neurosci. 2, 806–819 (2001).

Bruijn, L.I. et al. Aggregation und Motoneurontoxizität einer ALS-verknüpften SOD1-Mutante unabhängig von Wildtyp-SOD1. Wissenschaft 281, 1851–1854 (1998).

Rakhit, R. et al. Oxidationsinduzierte Fehlfaltung und Aggregation von Superoxiddismutase und ihre Auswirkungen auf die amyotrophe Lateralsklerose. J. Biol. Chem.-Nr. 277, 47551–47556 (2002).

Prusiner, S. B. Shattuck-Vortrag – neurodegenerative Erkrankungen und Prionen. N. Engl. J. Med. 344, 1516–1526 (2001).

Lindquist, S., Krobitsch, S., Li, L. & Sondheimer, N. Untersuchung der Proteinkonformations-basierten Vererbung und Krankheit in Hefe. Phil. Übers. R. Soc. Lange. B 356, 169–176 (2001).

Scheibel, T., Bloom, J. & Lindquist, S.L. Die Dehnung von Hefeprionfasern umfasst trennbare Schritte der Assoziation und Umwandlung. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 101, 2287–2292 (2004).

Ma, J., Wollmann, R. & Lindquist, S. Neurotoxizität und Neurodegeneration, wenn PrP im Zytosol akkumuliert. Wissenschaft 298, 1781–1785 (2002).

Ma, J. & Lindquist, S. Umwandlung von PrP in eine selbsterhaltende PrPSc-ähnliche Konformation im Cytosol. Wissenschaft 298, 1785–1788 (2002).

Eanes, E. D. & Glenner, G. G. Röntgenbeugungsuntersuchungen an Amyloidfilamenten. J. Histochem. Zytochem. 16, 673–677 (1968).

Sunde, M. & Blake, C.C. Vom globulären zum faserigen Zustand: Proteinstruktur und Strukturumwandlung bei der Amyloidbildung. Q. Rev. Biophys. 31, 1–39 (1998).

Benzinger, T. L. et al. Die sich ausbreitende Struktur des Alzheimer-β-Amyloids (10–35) ist ein paralleles β-Faltblatt mit exakt ausgerichteten Resten. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 95, 13407–13412 (1998).

Tycko, R. Einblicke in das Amyloidfaltungsproblem aus Festkörper-NMR. Biochemie 42, 3151–3159 (2003).

Torok, M. et al. Strukturelle und dynamische Eigenschaften des Alzheimer-Aβ-Peptids in Amyloidfibrillen, untersucht durch ortsgerichtete Spinmarkierung. J. Biol. Chem.-Nr. 277, 40810–40815 (2002).

Der-Sarkissian, A., Jao, C.C., Chen, J. & Langen, R. Strukturelle Organisation von α-Synuclein-Fibrillen, untersucht durch ortsgerichtete Spinmarkierung. J. Biol. Chem.-Nr. 278, 37530–37535 (2003).

Benzinger, T. L. et al. Zweidimensionale Struktur von β-Amyloid(10–35)-Fibrillen. Biochemie 39, 3491–3499 (2000).

Balbach, J. J. et al. Amyloidfibrillenbildung durch Aβ16–22, ein aus sieben Resten bestehendes Fragment des Alzheimer-β-Amyloidpeptids, und strukturelle Charakterisierung durch Festkörper-NMR. Biochemie 39, 13748–13759 (2000).

Williams, A. D. et al. Kartierung der Sekundärstruktur von Aβ-Amyloidfibrillen unter Verwendung von Scanning-Prolin-Mutagenese. J.Mol. Biol. 335, 833–842 (2004).

Thakur, A. K. & Wetzel, R. Mutationsanalyse der strukturellen Organisation von Polyglutamin-Aggregaten. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 99, 17014–17019 (2002).

Ross, C. A., Poirier, M. A., Wanker, E. E. &. Amzel, M. Polyglutaminfibrillogenese: Der Weg entfaltet sich. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 100, 1–3 (2003).

Chen, S., Berthelier, V., Hamilton, J. B., O'Nuallain, B. & Wetzel, R. Amyloid-like features of polyglutamine aggregats and their assembly kinetics. Biochemie 41, 7391–7399 (2002).

O'Nuallain, B. & Wetzel, R. Conformational Abs, die ein generisches Amyloid-Fibrillen-Epitop erkennen. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 99, 1485–1490 (2002).

Uversky, V. N. Proteinfaltung überarbeitet. Eine Polypeptidkette an der Kreuzung von Faltung, Fehlfaltung und Nichtfaltung: Welcher Weg soll gehen? Zelle Mol. Leben Sci. 60, 1852–1871 (2003).

Clarke, G. et al. Ein One-Hit-Modell des Zelltods bei erblichen neuronalen Degenerationen. Natur 406, 195–199 (2000).

Dobson, C. M. Prinzipien der Proteinfaltung, Fehlfaltung und Aggregation. Semin. Zell-Entw. Biol. 15, 3–16 (2004).

Sacchettini, J. C. & Kelly, J. W. Therapeutische Strategien für humane Amyloid-Erkrankungen. Nat. Rev. Drug Discovery. 1, 267–275 (2002).

Lansbury, P.T., Jr. Strukturelle Neurologie: Sind Samen die Wurzel der neuronalen Degeneration? Neuron 19, 1151–1154 (1997).

Soto, C. Entfaltung der Rolle der Proteinfehlfaltung bei neurodegenerativen Erkrankungen. Nat. Rev. Neurosci. 4, 49–60 (2003).

Singleton, A. B. et al. Die Verdreifachung des α-Synuclein-Locus verursacht die Parkinson-Krankheit. Wissenschaft 302, 841 (2003).

Singleton, A., Myers, A. & Hardy, J. Das Gesetz der Massenwirkung auf neurodegenerative Erkrankungen: eine Hypothese zur Ätiologie und Pathogenese komplexer Erkrankungen. Summen. Mol.-Nr. Genet. 13 (Sondernr. 1), R123–R126 (2004).

Conway, K. A., Rochet, J. C., Bieganski, R. M. & Lansbury, P. T., Jr. Kinetische Stabilisierung der α-Synuclein-Protofibrille durch ein Dopamin-α-Synuclein-Addukt. Wissenschaft 294, 1346–1349 (2001).

Giasson, B. I. et al. Oxidativer Schaden im Zusammenhang mit Neurodegeneration durch selektive α-Synuclein-Nitrierung bei Synucleinopathie-Läsionen. Wissenschaft 290, 985–989 (2000).

Iwatsubo, T. et al. Reinigung und Charakterisierung von Lewy-Körpern aus dem Gehirn von Patienten mit diffuser Lewy-Körper-Krankheit. Bin. J. Pathol. 148, 1517–1529 (1996).

Iwatsubo, T. Aggregation von α-Synuclein in der Pathogenese der Parkinson-Krankheit. J. Neurol. 250 (Suppl. 3), III11–III14 (2003).

Okochi, M. et al. Konstitutive Phosphorylierung des mit der Parkinson-Krankheit assoziierten α-Synucleins. J. Biol. Chem.-Nr. 275, 390–397 (2000).

Spillantini, M. G. et al. α-Synuclein in Lewy-Körperchen. Natur 388, 839–840 (1997).

Emamian, E. S. et al. Serin 776 von Ataxin-1 ist entscheidend für die durch Polyglutamin induzierte Erkrankung bei SCA1-transgenen Mäusen. Neuron 38, 375–387 (2003).

Steffan, J. S. et al. Modifikation der Pathologie der Huntingtin- und Huntington-Krankheit. Wissenschaft 304, 100–104 (2004).

DiFiglia, M. et al. Aggregation von Huntingtin in neuronalen intranukleären Einschlüssen und dystrophischen Neuriten im Gehirn. Wissenschaft 277, 1990–1993 (1997).

Saudou, F., Finkbeiner, S., Devys, D. & Greenberg, M. E. Huntingtin wirkt im Kern, um Apoptose zu induzieren, aber der Tod korreliert nicht mit der Bildung intranukleärer Einschlüsse. Zelle 95, 55–66 (1998).

Peters, M. F. et al. Nukleares Targeting von mutiertem Huntingtin erhöht die Toxizität. Mol.-Nr. Zellneurosci. 14, 121–128 (1999).

de Almeida, LP, Ross, CA, Zala, D., Aebischer, P. &. Deglon, N. Die Lentiviral-vermittelte Abgabe von mutiertem Huntingtin im Striatum von Ratten induziert eine selektive Neuropathologie, die durch die Polyglutamin-Wiederholungsgröße, Huntingtin-Expressionsniveaus moduliert wird, und Proteinlänge. J. Neurosci. 22, 3473–3483 (2002).

Wellington, C. L. et al. Die Caspase-Spaltung von mutiertem Huntingtin geht der Neurodegeneration bei der Huntington-Krankheit voraus. J. Neurosci. 22, 7862–7872 (2002).

Gafni, J. et al. Die Hemmung der Calpain-Spaltung von Huntingtin reduziert die Toxizität: Ansammlung von Calpain/Caspase-Fragmenten im Zellkern. J. Biol. Chem.-Nr. 279, 21211–21220 (2004).

Lunkes, A. et al. Proteasen, die auf mutiertes Huntingtin wirken, erzeugen gespaltene Produkte, die unterschiedlich zytoplasmatische und nukleäre Einschlüsse aufbauen. Mol.-Nr. Zelle 10, 259–269 (2002).

Poirier, M. A. et al. Huntingtin-Sphäroide und Protofibrillen als Vorläufer bei der Polyglutaminfibrillierung. J. Biol. Chem.-Nr. 277, 41032–41037 (2002).

Nucifora, F. C., Jr. et al. Die nukleäre Lokalisation eines Nicht-Caspase-Trunkierungsprodukts von Atrophin-1 mit einem erweiterten Polyglutamin-Repeat erhöht die zelluläre Toxizität. J. Biol. Chem.-Nr. 278, 13047–13055 (2003).

Lee, E. N. et al. Phthalocyanintetrasulfonate beeinflussen die Amyloidbildung und Zytotoxizität von α-Synuclein. Biochemie 43, 3704–3715 (2004).

Buxbaum, J. N. Erkrankungen der Proteinkonformation: Was tun? in vitro Experimente erzählen uns davon in vivo Krankheiten? Trends Biochem. Wissenschaft 28, 585–592 (2003).

Wetzel, R. Ordnungsideen für die Struktur der Amyloidfibrillen. Struktur (Kamm) 10, 1031–1036 (2002).

Soreghan, B., Kosmoski, J. & Glabe, C. Tensideigenschaften von Alzheimer-Aβ-Peptiden und der Mechanismus der Amyloid-Aggregation. J. Biol. Chem.-Nr. 269, 28551–28554 (1994).

Harper, J. D., Lieber, C. M. &. Lansbury, P. T., Jr. Rasterkraftmikroskopische Bildgebung der Bildung von beimpften Fibrillen und der Fibrillenverzweigung durch das Amyloid-β-Protein der Alzheimer-Krankheit. Chem.-Nr. Biol. 4, 951–959 (1997).

Lambert, M. P. et al. Diffusionsfähige, nichtfibrilläre Liganden, die von Aβ1–42 abgeleitet sind, sind potente Neurotoxine des zentralen Nervensystems. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 95, 6448–6453 (1998).

Harper, J. D., Wong, S. S., Lieber, C. M. & Lansbury, P.T., Jr. Assemblierung von Aβ-Amyloid-Protofibrillen: an in vitro Modell für ein mögliches frühes Ereignis bei der Alzheimer-Krankheit. Biochemie 38, 8972–8980 (1999).

Harper, J. D. & Lansbury, P. T., Jr. Modelle der Amyloid-Aussaat bei Alzheimer-Krankheit und Scrapie: mechanistische Wahrheiten und physiologische Konsequenzen der zeitabhängigen Löslichkeit von Amyloid-Proteinen. Annu. Rev. Biochem. 66, 385–407 (1997).

Walsh, D. M., Lomakin, A., Benedek, G. B., Condron, M. M. & Teplow, D. B. Amyloid-β-Protein-Fibrillogenese. Nachweis eines protofibrillären Intermediats. J. Biol. Chem.-Nr. 272, 22364–22372 (1997).

Klein, W. L., Krafft, G. A. & Finch, C. E. Targeting von kleinen Aβ-Oligomeren: die Lösung für ein Rätsel der Alzheimer-Krankheit? Trends Neurosci. 24, 219–224 (2001).

Terry, R. D. et al. Physikalische Grundlage kognitiver Veränderungen bei der Alzheimer-Krankheit: Synapsenverlust ist das Hauptkorrelat kognitiver Beeinträchtigungen. Ann. Neurol. 30, 572–580 (1991).

McLean, C. A. et al. Löslicher Pool von Aβ-Amyloid als Determinante für den Schweregrad der Neurodegeneration bei der Alzheimer-Krankheit. Ann. Neurol. 46, 860–866 (1999).

Lue, L. F. et al. Lösliche Amyloid-β-Peptidkonzentration als Prädiktor für synaptische Veränderungen bei der Alzheimer-Krankheit. Bin. J. Pathol. 155, 853–862 (1999).

Walsh, D. M. et al. Natürlich sekretierte Oligomere des Amyloid-β-Proteins hemmen die langfristige Potenzierung im Hippocampus stark in vivo. Natur 416, 535–539 (2002).

Volles, M. J. et al. Vesikelpermeabilisierung durch protofibrilläres α-Synuclein: Implikationen für die Pathogenese und Behandlung der Parkinson-Krankheit. Biochemie 40, 7812–7819 (2001).

Sharon, R. et al. Die Bildung hochlöslicher Oligomere von α-Synuclein wird durch Fettsäuren reguliert und bei der Parkinson-Krankheit verstärkt. Neuron 37, 583–595 (2003).

Chen, S., Berthelier, V., Yang, W. & Wetzel, R. Polyglutamin-Aggregationsverhalten in vitro unterstützt einen Rekrutierungsmechanismus der Zytotoxizität. J.Mol. Biol. 311, 173–182 (2001).

Sanchez, I., Mahlke, C. & Yuan, J. Entscheidende Rolle der Oligomerisierung bei neurodegenerativen Erkrankungen mit expandiertem Polyglutamin. Natur 421, 373–379 (2003).

Nucifora, F. C., Jr. et al. Interferenz durch Huntingtin und Atrophin-1 mit der CBP-vermittelten Transkription, die zu zellulärer Toxizität führt. Wissenschaft 291, 2423–2428 (2001).

Jiang, H., Nucifora, F.C., Jr., Ross, C.A. & DeFranco, D. B. Der Zelltod, der durch Polyglutamin-expandiertes Huntingtin in einer neuronalen Zelllinie ausgelöst wird, ist mit dem Abbau des CREB-bindenden Proteins verbunden. Summen. Mol.-Nr. Genet. 12, 1–12 (2003).

Bence, N. F., Sampat, R. M. &. Kopito, R. R. Impairment of the Ubiquitin-Proteasom-System durch Proteinaggregation. Wissenschaft 292, 1552–1555 (2001).

Kayed, R. et al. Die gemeinsame Struktur löslicher Amyloid-Oligomere impliziert einen gemeinsamen Pathogenesemechanismus. Wissenschaft 300, 486–489 (2003).

McClellan, A. J. & Frydman, J. Molekulare Chaperone und die Kunst, eine verlorene Sache zu erkennen. Nat. Zellbiol. 3, E51–E53 (2001).

Goldberg, A.L. Proteinabbau und Schutz vor falsch gefalteten oder beschädigten Proteinen. Natur 426, 895–899 (2003).

Ciechanover, A. & Brundin, P. Das Ubiquitin-Proteasom-System bei neurodegenerativen Erkrankungen: mal das Huhn, mal das Ei. Neuron 40, 427–446 (2003).

Kopito, R. R. Aggresomes, Inclusion Bodies and Protein Aggregation. Trends Zellbiol. 10, 524–530 (2000).

Ravikumar, B. et al. Inhibitor von mTOR induziert Autophagie und reduziert die Toxizität von Polyglutamin-Expansionen in Fliegen- und Mausmodellen der Huntington-Krankheit. Nat. Genet. 36, 585–595 (2004).

Tanaka, M. et al. Aggresomen, die von α-Synuclein und Synphilin-1 gebildet werden, wirken zytoprotektiv. J. Biol. Chem.-Nr. 279, 4625–4631 (2004).

Verhoef, L. G., Lindsten, K., Masucci, M. G. & Dantuma, N. P. Die Aggregatbildung hemmt den proteasomalen Abbau von Polyglutaminproteinen. Summen. Mol.-Nr. Genet. 11, 2689–2700 (2002).

Winklhofer, K. F., Reintjes, A., Hoener, M. C., Voellmy, R. & Tatzelt, J.Geldanamycin stellt eine defekte Hitzeschockreaktion wieder her in vivo. J. Biol. Chem.-Nr. 276, 45160–45167 (2001).

Piper, P. W. Das Hsp90-Chaperon als vielversprechendes Wirkstoffziel. Curr. Meinung. Untersuchung Drogen 2, 1606–1610 (2001).

Yamamoto, A., Lucas, J.J. & Hen, R. Umkehr der Neuropathologie und motorischen Dysfunktion in einem konditionalen Modell der Huntington-Krankheit. Zelle 101, 57–66 (2000).

Davidson, B. L. & Paulson, H. L. Molekulare Medizin für das Gehirn: Abschalten von Krankheitsgenen durch RNA-Interferenz. Lancet Neurol. 3, 145–149 (2004).

Müller, V. M. et al. Allelspezifisches Silencing dominanter Krankheitsgene. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 100, 7195–7200 (2003).

Monsonego, A. & Weiner, H. L. Immuntherapeutische Ansätze zur Alzheimer-Krankheit. Wissenschaft 302, 834–838 (2003).

Mattson, M. P. & Chan, S. L. Gute und schlechte Amyloid-Antikörper. Wissenschaft 301, 1847–1849 (2003).

Weiner, H. L. &. Selkoe, D. J. Entzündung und therapeutische Impfung bei ZNS-Erkrankungen. Natur 420, 879–884 (2002).

Tanaka, M. et al. Trehalose lindert die Polyglutamin-vermittelte Pathologie in einem Mausmodell der Huntington-Krankheit. Nat. Med. 10, 148–154 (2004).

Bohrmann, B. et al. Die Selbstorganisation von β-Amyloid 42 wird durch kleinmolekulare Liganden im Stadium der strukturellen Zwischenstufen verzögert. J. Struktur. Biol. 130, 232–246 (2000).

Wood, S. J., MacKenzie, L., Maleeff, B., Hurle, M. R. & Wetzel, R. Selective inhibition of Aβ Fibril formation. J. Biol. Chem.-Nr. 271, 4086–4092 (1996).

Reixach, N., Crooks, E., Ostresh, J. M., Houghten, R. A. & Blondelle, S. E. Hemmung der β-Amyloid-induzierten Neurotoxizität durch Imidazopyridoindole, die aus einer synthetischen kombinatorischen Bibliothek stammen. J. Struktur. Biol. 130, 247–258 (2000).

Mai, v. et al. Starke Hemmung der Scrapie-Prion-Replikation in kultivierten Zellen durch Bisacridine. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 100, 3416–3421 (2003).

Cordeiro, Y., Lima, LM, Gomes, MP, Foguel, D. & Silva, JL ,5'-Sulfonat (bis-ANS). J. Biol. Chem.-Nr. 279, 5346–5352 (2004).

Heiser, V. et al. Identifizierung von Benzothiazolen als potenzielle Inhibitoren der Polyglutamin-Aggregation der Huntington-Krankheit mithilfe eines automatisierten Filterverzögerungsassays. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 99, 16400–16406 (2002).

Pollitt, S. K. et al. Ein schneller zellulärer FRET-Assay der Polyglutamin-Aggregation identifiziert einen neuen Inhibitor. Neuron 40, 685–694 (2003).

John, V., Beck, J. P., Bienkowski, M. J., Sinha, S. &. Heinrikson, R. L. Humane β-Sekretase (BACE) und BACE-Inhibitoren. J. Med. Chem.-Nr. 46, 4625–4630 (2003).

Petkova, A. T. et al. Ein Strukturmodell für Alzheimer-β-Amyloid-Fibrillen basierend auf experimentellen Einschränkungen aus Festkörper-NMR. Proz. Nat. Akad. Wissenschaft Vereinigte Staaten von Amerika 99, 16742–16747 (2002).


Diskussion

Die FU Gen

In der vorliegenden Arbeit wird die FU Gen identifiziert und seine Struktur bestimmt. FU besteht aus 29 Exons, von denen die Exons 1 und 2 für 5'UTRs kodieren, Exon 3 das initiierende ATG-Codon enthält und die Exons 13 und 29 Stopcodons im Leserahmen enthalten (Fig. 1). Exon 1 und 2 können als alternative erste Exons dienen, wie die alternativen Exons 1, 1A und 1B im PTCH1 Gen [23]. Die Exons 3 bis 9 kodieren für die Kinasedomäne. Dieses Segment weist eine starke Ähnlichkeit mit Drosophila fu auf, während der verbleibende C-terminale Teil eine viel schwächere Ähnlichkeit aufweist [8]. Unter Verwendung des DIALIGN-Programms [24] ist es möglich, in zwei Regionen im C-terminalen Teil (nicht gezeigt) fu auf L-FU auszurichten. Diese werden größtenteils von den Exons 15–16 und 22–29 kodiert. Dies deutet darauf hin, dass die Exons 10–14 und 17–21 möglicherweise an die rekrutiert wurden FU Gen während der Evolution.

Untersuchungen von Syndaktylie-Patientenmaterial

Wir haben die Möglichkeit untersucht, dass FU liegt SD1 zugrunde, da FU innerhalb des Lokalisierungsintervalls für SD1 liegt und Teil des Sonic Hedgehog-Signalweges ist, der an der digitalen Musterbildung beteiligt ist [1]. Obwohl drei zuvor beschriebene Einzelnukleotid-Polymorphismen identifiziert wurden, konnten wir keine Mutation in der FU kodierende Region oder flankierende intronische Regionen. Obwohl diese Ergebnisse nicht implizieren, FU bei der Ursache von SD1 ist es möglich, dass diese Störung durch Mutationen in den nicht kodierenden Regionen verursacht wird, die in dieser Studie nicht gescreent wurden. Alternativ könnte SD1 durch eine genomische Umlagerung verursacht werden, die nicht durch Sequenzanalyse identifiziert wurde, obwohl bei einem betroffenen Mitglied der SD1-Familie durch Southern-Analyse unter Verwendung von a . keine veränderten Banden nachgewiesen wurden FU cDNA-Klon als Sonde (Daten nicht gezeigt).

Expressionsanalysen

Analysen von FU Expression haben gezeigt, dass Transkripte in allen untersuchten Geweben nachgewiesen werden. Zum ersten Mal werden Beweise vorgelegt, die zeigen, dass von diesem Gen mehr als ein Transkript exprimiert werden kann. Die Northern Blots zeigen deutlich, dass tatsächlich FU-Transkripte unterschiedlicher Größe existieren. Hier sind die Transkripte schätzungsweise etwas größer als zuvor berichtet und in einigen Geweben ist mehr als ein Transkript erkennbar. Aus den verfügbaren cDNAs und RT/PCR-basierten Transkriptanalysen geht klar hervor, dass alternatives Spleißen auftritt. Darüber hinaus ist auch klar, dass in den Transkripten unterschiedliche 5'UTRs vorhanden sind. Neben dem zuvor beschriebenen L-FU [8] können mindestens zwei Proteinisoformen hergestellt werden. Die S-FU-Isoform unterscheidet sich am stärksten von L-FU und besteht nur aus dem N-terminalen Drittel von L-FU. Die S-FU-Expression resultiert aus der Aufnahme von Exon 13 in das reife Transkript. Dieses alternative Spleißereignis wurde in allen untersuchten Geweben und in einem scheinbar konstanten Verhältnis nachgewiesen. Auch ein Fall von reguliertem alternativem Spleißen wurde durch RT/PCR nachgewiesen, jedoch mit einer viel weniger dramatischen Auswirkung auf Proteinebene, da es nur zum Verlust von 21 Resten, die von Exon 24 kodiert werden, führt. Die Expression zeigt jedoch eine mögliche gewebespezifische Regulierung dieses alternativen Spleißereignisses. Dies kann gut widerspiegeln, dass L-FUΔ24 eine andere biologische Rolle als L-FU spielt. Da die mRNA für L-FUΔ24 anscheinend nicht im Dünndarm und in der Prostata exprimiert wird, kann spekuliert werden, dass FU dort eine andere Rolle spielt, wenn ein Leucin-Zipper in L-FUΔ24 wirklich verloren geht. Es ist faszinierend, dass der Hoden Transkripte sowohl mit als auch ohne das 63 bp-Segment zu exprimieren scheint und auch das Gewebe mit der stärksten Expression ist. Möglicherweise hängt die Expression von L-FUΔ24 und L-FU zusammen mit der Funktion von Desert Hedgehog zusammen, von der gezeigt wurde, dass sie eine besondere Rolle bei der Spermatogenese spielt [25]. Ob Interaktionen mit GLI-Proteinen, SUFU oder anderen Komponenten des Signalweges verändert werden und ob dies Auswirkungen auf die GLI- oder SUFU-Aktivitäten hat, muss noch untersucht werden. Dies fügt dem komplizierten Bild der Hedgehog-Signalgebung und der GLI-Regulierung bei Wirbeltieren sicherlich eine weitere Variable hinzu.

Funktionsuntersuchungen und Perspektiven

Die Bewertung der Funktionalität ergab, dass S-FU nicht in der Lage war, GLI1 oder GLI2 zu regulieren, wenn es in 293-Zellen exprimiert wurde. Im Gegensatz dazu waren sowohl L-FU als auch eine Variante ohne vollständige Kinasedomäne (2HFU) in der Lage, die GLI2-induzierte Transkription zu verstärken. Diese Ergebnisse sind qualitativ ähnlich denen, die zuvor in C3H/10T½-Zellen berichtet wurden [8]. L-FU und 2HFU waren nur in der Lage, die GLI2-Aktivität in 293-Zellen um das 2- bis 3-fache zu steigern, während in C3H/10T½-Zellen 5- bis 8-fache Induktionen beobachtet werden. Dies könnte die Tatsache widerspiegeln, dass die letztgenannte Zelllinie zusätzliche Komponenten des Hedgehog-Signalwegs exprimiert, die für die volle Aktivität von FU erforderlich sind. Im Gegensatz zu den bisherigen Untersuchungen [8] konnte kein Effekt von L-FU auf SUFU festgestellt werden. Auch dieser Unterschied kann durch die verschiedenen Eigenschaften der verwendeten Zelllinien erklärt werden. Das Verständnis der Signalereignisse stromabwärts von SMO kann funktionelle Unterschiede der beteiligten Proteine ​​im Vergleich zu ihren Fruchtfliegen-Gegenstücken aufdecken. Obwohl SUFU GLI-Transkriptionsfaktoren hemmt und su(fu) Ci hemmt, gibt es immer noch auffallende Unterschiede. Bisher gibt es keine Berichte über ein cos2-Gegenstück bei Wirbeltieren. Stattdessen wurde beobachtet, dass FU mit allen GLI-Proteinen und SUFU interagiert [8], obwohl fu nicht an Ci bindet [26]. Es wurde auch beobachtet, dass sowohl L-FU als auch SUFU im Kern gefunden werden können [5–8], was für fu oder su(fu) nicht beobachtet wurde. Es ist wahrscheinlich, dass sowohl FU als auch SUFU durch Bindung an GLI-Proteine ​​in den und aus dem Zellkern transportiert werden [5, 8]. Obwohl die grundlegenden Aktivitäten von FU und SUFU bei der Regulierung von GLI konserviert wurden, scheint es auch signifikante Unterschiede zu ihren Fruchtfliegen-Gegenstücken zu geben. Offensichtlich hat FU auf GLI1 keine ähnliche Wirkung wie auf GLI2. Zusätzliche Untersuchungen sind erforderlich, um die Rolle von FU bei der Hedgehog-Signalgebung und der GLI-Kontrolle zu ermitteln. Auch die Rolle der verschiedenen Isoformen muss noch geklärt werden. Diese müssen einzeln auf ihre Regulation aller GLI-Proteine ​​und proteolytischen Produkte getestet werden. Es ist bekannt, dass Fu in der Fliege mindestens zwei separate physiologische Funktionen hat, von denen eine von der Kinasedomäne abhängt [27]. Ebenso kann FU gut zwei oder mehr verschiedene Funktionen bei der Signalübertragung haben, die durch verschiedene Domänen, Isoformen und Proteininteraktionen repräsentiert werden.


Ergebnisse

Patientenmutationen in KDM5C

Wir erhielten Fibroblasten von sieben Patienten, die an XLID litten, das durch vier unabhängige Mutationen in verursacht wurde KDM5C (Tabelle 1). Die Lage der Mutationen in Bezug auf die annotierten Merkmale des KDM5C-Proteins ist in 1A gezeigt. Die Mutationen und klinischen Symptome wurden bereits für p.D402Y (12), p.P480L (22) und c.2T>C (23) berichtet. Der Patient mit der c.3223delG (p.V1075Yfs*2)-Mutation zeigte eine schwere ID mit Entwicklungsverzögerung, Kleinwuchs (5.–10. Perzentil) und Hyperreflexie. Patient 3223delG-1 ging nach 22 Monaten, sprach im Alter von 13,5 Jahren nur noch 6–8 Wörter und zeigte Strabismus, einen hohen schmalen Gaumen und Verstopfung. Wir untersuchten auch Fibroblasten einer weiblichen heterozygoten Trägerin der c.3223delG-Mutation (3223delG-HET Mutter des betroffenen Mannes), die in der Schule Nachhilfe brauchte und einen hohen schmalen Gaumen hat. Die Schwester des Patienten (nicht untersucht) ist ebenfalls Trägerin der Mutation und weist eine leichte geistige Behinderung, Entwicklungsverzögerung, Hyperreflexie und einen hohen schmalen Gaumen auf, was darauf hindeutet, dass die Mutation im heterozygoten Umfeld schädlich sein kann. Als Kontrollen erhielten wir BJ-Vorhautfibroblasten von Dr. George Q Daley (Boston Children's Hospital) und kontrollieren männliche Hautfibroblasten aus dem Coriell Cell Repository (Kontrolle-1: GM03348, 10 Jahre Kontrolle-2: AG06234, 17 Jahre).

Informationen zu Patientenfibroblasten

. Patientenkennung . Familie . Alter bei Biopsie (Jahr) . cDNA-Mutation. Proteinmutation. ICH WÜRDE . Klinische Hinweise.
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, Aggression
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, seltene Anfälle, Aggression
P480L-1 13185 K9330 8 c.1439C>T S.P480L Mäßig DD, Strabismus, leichte Skoliose
P480L-2 13186 K9330 1 c.1439C>T S.P480L Leicht DD, Kleinwuchs, Zittern, Krampfanfälle, Aggression
2T>C-1 13008 23 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Strabismus, Krampfanfälle, Ataxie, Aggression
2T>C-2 13009 13 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Ataxie,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Schwer DD, Kleinwuchs, Strabismus, Hyperreflexie,
. Patientenkennung . Familie . Alter bei Biopsie (Jahr) . cDNA-Mutation. Proteinmutation. ICH WÜRDE . Klinische Hinweise.
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, Aggression
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, seltene Anfälle, Aggression
P480L-1 13185 K9330 8 c.1439C>T S.P480L Mäßig DD, Strabismus, leichte Skoliose
P480L-2 13186 K9330 1 c.1439C>T S.P480L Leicht DD, Kleinwuchs, Zittern, Krampfanfälle, Aggression
2T>C-1 13008 23 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Strabismus, Krampfanfälle, Ataxie, Aggression
2T>C-2 13009 13 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Ataxie,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Schwer DD, Kleinwuchs, Strabismus, Hyperreflexie,

Anmerkungen basierend auf Homo sapiens Lysin (K)-spezifischer Demethylase 5C (KDM5C) Transkript Variante 1 (uc004drz.3/NM_004187) in der GRCh38/hg38 Genomanordnung.

ID, geistige Behinderung DD, Entwicklungsverzögerung.

Informationen zu Patientenfibroblasten

. Patientenkennung . Familie . Alter bei Biopsie (Jahr) . cDNA-Mutation. Proteinmutation. ICH WÜRDE . Klinische Hinweise.
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, Aggression
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, seltene Anfälle, Aggression
P480L-1 13185 K9330 8 c.1439C>T S.P480L Mäßig DD, Strabismus, leichte Skoliose
P480L-2 13186 K9330 1 c.1439C>T S.P480L Leicht DD, Kleinwuchs, Zittern, Krampfanfälle, Aggression
2T>C-1 13008 23 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Strabismus, Krampfanfälle, Ataxie, Aggression
2T>C-2 13009 13 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Ataxie,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Schwer DD, Kleinwuchs, Strabismus, Hyperreflexie,
. Patientenkennung . Familie . Alter bei Biopsie (Jahr) . cDNA-Mutation. Proteinmutation. ICH WÜRDE . Klinische Hinweise.
D402Y-1 38505 A034 72 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, Aggression
D402Y-2 38506 A034 67 c.1204G>T p.D402Y Mäßig bis schwer DD, Kleinwuchs, seltene Anfälle, Aggression
P480L-1 13185 K9330 8 c.1439C>T S.P480L Mäßig DD, Strabismus, leichte Skoliose
P480L-2 13186 K9330 1 c.1439C>T S.P480L Leicht DD, Kleinwuchs, Zittern, Krampfanfälle, Aggression
2T>C-1 13008 23 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Strabismus, Krampfanfälle, Ataxie, Aggression
2T>C-2 13009 13 c.2T>C p.M1_E165del Schwer DD, Kleinwuchs, Ataxie,
3223delG-1 22986 K9607 17 c.3223delG p.V1075Yfs*2 Schwer DD, Kleinwuchs, Strabismus, Hyperreflexie,

Anmerkungen basierend auf Homo sapiens Lysin (K)-spezifischer Demethylase 5C (KDM5C) Transkript Variante 1 (uc004drz.3/NM_004187) in der GRCh38/hg38 Genomanordnung.

ID, geistige Behinderung DD, Entwicklungsverzögerung.

Die c.3223delG-Mutation schließt die KDM5C-Expression aus, aber andere Patientenmutationen sind mit der Transkript- und Proteinproduktion kompatibel. (EIN) Schema der KDM5C-Proteinstruktur, mit Domänen und Patientenmutationen angegeben. M166 ist das vorhergesagte Startcodon für Patienten mit der c.2T>C-Mutation. Der KDM5C-Antikörper wird gegen die C-terminalen 100 Aminosäuren des Proteins erzeugt. (B) Analyse von KDM5C RNA, die entweder mit Zufallsprimern (gefüllte Balken) oder Oligo-dT-Primern (offene Balken) amplifiziert wurde, zeigt, dass KDM5C RNA wird bei betroffenen Männern mit den Mutationen p.D402Y, p.P480L oder c.2T>C nachgewiesen, nicht jedoch bei den betroffenen Männern mit der Mutation c.3223delG. Mittelwert und Standardabweichung von 3–4 unabhängigen Experimenten werden angezeigt (*P < 0,01 im Vergleich zu Kontrolle-1, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Kontroll-1-Fibroblasten. (C) Ganzzelllysate aus Hautfibroblasten von Patienten zeigen eine KDM5C-Proteinexpression bei betroffenen Männern, die die p.P480L- und p.D402Y-Mutationen aufweisen. Bei dem von c.3223delG betroffenen Mann wurde keine Expression nachgewiesen. Männchen, die die c.2T>C-Mutation tragen, produzieren ein verkürztes KDM5C-Produkt. Die unterste Bande x ist unspezifisch. TUBULIN, Ladekontrolle. (D) KDM5C-shRNAs reduzieren KDM5C Transkript in Kontroll-BJ- und c.2T>C-Fibroblasten. Mittelwert und Standardabweichung von zwei unabhängigen Experimenten werden angezeigt (*P < 0,05 im Vergleich zu FF, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Kontroll-shRNA-Proben (FF, Glühwürmchen-Luciferase). (E) Western-Blots zeigen, dass das in c.2T>C-Fibroblasten produzierte verkürzte Produkt bei KDM5C-shRNA-Behandlung reduziert wird, was darauf hindeutet, dass es spezifisch ist. Die unterste Bande x ist unspezifisch. ACTIN, Ladekontrolle.

Die c.3223delG-Mutation schließt die KDM5C-Expression aus, aber andere Patientenmutationen sind mit der Transkript- und Proteinproduktion kompatibel. (EIN) Schema der KDM5C-Proteinstruktur, mit Domänen und Patientenmutationen angegeben. M166 ist das vorhergesagte Startcodon für Patienten mit der c.2T>C-Mutation. Der KDM5C-Antikörper wird gegen die C-terminalen 100 Aminosäuren des Proteins erzeugt. (B) Analyse von KDM5C RNA, die entweder mit Zufallsprimern (gefüllte Balken) oder Oligo-dT-Primern (offene Balken) amplifiziert wurde, zeigt, dass KDM5C RNA wird bei betroffenen Männern mit den Mutationen p.D402Y, p.P480L oder c.2T>C nachgewiesen, nicht jedoch bei den betroffenen Männern mit der Mutation c.3223delG. Mittelwert und Standardabweichung von 3–4 unabhängigen Experimenten werden angezeigt (*P < 0,01 im Vergleich zu Kontrolle-1, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Kontroll-1-Fibroblasten. (C) Ganzzelllysate aus Patientenhautfibroblasten zeigen eine KDM5C-Proteinexpression bei betroffenen Männern, die die p.P480L- und p.D402Y-Mutationen aufweisen. Bei dem von c.3223delG betroffenen Mann wurde keine Expression nachgewiesen. Männchen, die die c.2T>C-Mutation tragen, produzieren ein verkürztes KDM5C-Produkt. Die unterste Bande x ist unspezifisch. TUBULIN, Ladekontrolle. (D) KDM5C-shRNAs reduzieren KDM5C Transkript in Kontroll-BJ- und c.2T>C-Fibroblasten. Mittelwert und Standardabweichung von zwei unabhängigen Experimenten werden angezeigt (*P < 0,05 im Vergleich zu FF, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Kontroll-shRNA-Proben (FF, Glühwürmchen-Luciferase). (E) Western-Blots zeigen, dass das verkürzte Produkt, das in c.2T>C-Fibroblasten produziert wird, bei KDM5C-shRNA-Behandlung reduziert wird, was darauf hindeutet, dass es spezifisch ist. Die unterste Bande x ist unspezifisch. ACTIN, Ladekontrolle.

Patientenmutationen reduzieren den KDM5C-Proteinspiegel

Wir analysierten zunächst die Wirkung der genetischen Mutationen auf das RNA-Expressionsniveau von KDM5C in Patienten- und Kontrollfibroblasten mittels qRT-PCR (quantitative reverse Transkription mit PCR Abb. 1B). Wir analysierten sowohl Gesamt-RNA, amplifiziert unter Verwendung zufälliger Hexamere (gefüllte Balken) als auch polyadenylierte mRNA, amplifiziert unter Verwendung von Oligo-dT-Primern (offene Balken). Patientenfibroblasten mit p.D402Y-, p.P480L- und c.2T>C-Mutationen exprimiert KDM5C. Es gab jedoch eine signifikante Verringerung der Gesamt- und polyadenylierten KDM5C RNA in Fibroblasten mit der p.P480L-Mutation und insgesamt KDM5C RNA in Fibroblasten mit der p.D402Y-Mutation. KDM5C mRNA-Spiegel in c.3223delG-Fibroblasten wurden dramatisch auf ~15% der Kontrollzelllinien reduziert, was damit übereinstimmt, dass die resultierende mRNA auf Nonsense-vermittelten mRNA-Zerfall abzielt (NMD Fig. 1B). KDM5C Die mRNA-Spiegel in den weiblichen c.3223delG-Trägern waren im Vergleich zu den Kontrollhautfibroblasten leicht, aber signifikant reduziert.

KDM5C ist ein Mitglied der KDM5-Demethylase-Familie und KDM5C-Homologe könnten den KDM5C-Funktionsverlust kompensieren. Wir haben daher das mRNA-Expressionsniveau von Mitgliedern der KDM5-Familie analysiert KDM5A, KDM5B und KDM5D (auch bekannt als RBP2, PLU-1 und SMCY), um zu sehen, ob diese in Patientenfibroblasten mit KDM5C Mutationen (Ergänzungsmaterial, Abb. S1 A). Ebenen von KDM5A Die mRNA war in allen Patienten- und Kontroll-Fibroblastenlinien vergleichbar. Ebenen von KDM5B RNA war in P480L-2, 2T>C-1, 3223delG-1 und 3223delG-HET leicht, aber signifikant reduziert. Y-verknüpft SMCY war bei der Trägerin wie erwartet nicht nachweisbar, aber in ähnlichen Konzentrationen bei betroffenen Männern und Kontrollen vorhanden.

c.1204G>T und c.1439C>T sind Missense-Mutationen, von denen vorhergesagt wird, dass sie zu einem KDM5C-Protein voller Länge mit einer Aminosäuresubstitution an einem einzelnen Rest führen: p.D402Y bzw. p.P480L. Wie vorhergesagt, haben wir KDM5C-Protein mit dem erwarteten Molekulargewicht (176 kDa) auf Western-Blots von Ganzzell-Lysaten aus Fibroblasten mit c.1204G>T- und c.1439C>T-Mutationen (Fig. 1C) unter Verwendung eines gegen den C-Terminus von KDM5C . erzeugten Antikörpers nachgewiesen (Abb. 1A). Im Gegensatz dazu wird vorhergesagt, dass c.3223delG eine Rasterverschiebungsmutation verursacht, die ein vorzeitiges Terminationscodon (PTC) an der Position unmittelbar nach der ersten veränderten Aminosäure (p.V1075Yfs*2) einführt. Dies steht im Einklang mit den niedrigen Werten von KDM5C In 3223delG-1-Fibroblasten nachgewiesene RNA (Fig. 1B) und wir erwarteten keine Proteinproduktion. Wir haben kein KDM5C-Protein in c.3223delG-Fibroblasten nachgewiesen ( 1C ), aber der KDM5C-Antikörper wird auf den Teil von KDM5C jenseits des PTC ( 1A ) erhöht und würde daher kein möglicherweise verkürztes Produkt nachweisen. Interessanterweise haben wir das KDM5C-Protein in Fibroblasten mit der c.2T>C-Mutation im Translationsstartcodon von . nachgewiesen KDM5C (Abb. 1C). Das c.2T>C-KDM5C-Protein läuft bei einem niedrigeren Molekulargewicht als Wildtyp-KDM5C, was die Produktion eines N-terminal verkürzten Proteins im Leserahmen nahelegt. Wichtig ist, dass die globalen Konzentrationen des KDM5C-Proteins in allen Patientenlinien im Vergleich zu den Kontrollen niedriger sind ( 1C ).

Um zu verifizieren, dass die in KDM5C-Western-Blots von c.2T>C-Fibroblasten beobachtete Bande mit niedrigerem Molekulargewicht eine alternative Version von KDM5C ist, behandelten wir Kontroll- und c.2T>C-Fibroblasten mit shRNAs-Targeting KDM5C. Die qRT-PCR-Analyse bestätigte, dass zwei KDM5C shRNAs reduzierten die Spiegel von KDM5C Transkripte in Kontroll- und c.2T>C-Patientenzellen verglichen mit nicht infizierten und Kontroll-shRNA-infizierten (FF, Glühwürmchen-Luciferase)-Proben ( 1D ). Die Western-Blot-Analyse zeigte, dass KDM5C shRNA-Konstrukte verringern das KDM5C-Signal voller Länge in Kontrollfibroblasten und verringern auch das Signal mit niedrigerem Molekulargewicht in c.2T>C-Fibroblasten ( 1E ), was bestätigt, dass das von dem KDM5C-Antikörper in diesen Patientenzellen erkannte Protein tatsächlich KDM5C verkürzt ist.

C.2T>C-Patienten exprimieren N-terminal verkürztes p.M1_E165del KDM5C-Protein

Vorhersagealgorithmen für die Translationsinitiationsstelle, die auf der DNA-Sequenz basieren, nehmen vor, dass, wenn die c.2T>C-Mutation vorhanden ist, die KDM5C-Translation am Methionin (M) an Position 166 beginnt, was darauf hindeutet, dass das verkürzte Protein p.M1_E165del ist. M166 befindet sich im Raster mit dem kanonischen Startcodon, entsprechend der Erkennung der verkürzten Form durch einen Antikörper, der gegen den C-Terminus von KDM5C erzeugt wurde ( 1A ). p.M1_E165del ist 20 kDa kleiner als der Wildtyp (156 vs. 176 kDa), was mit dem bei Western beobachteten Molekulargewichtsunterschied übereinstimmt (Abb. 1C), und es fehlen die hochkonservierten JmjN und ARID (AT-reiche interaktive Domäne). Domänen (Abb. 1A).

Um die Hypothese zu testen, dass c.2T>C-Patientenzellen p.M1_E165del KDM5C produzieren, erzeugten wir C-terminal markierte KDM5C-Expressionskonstrukte, die entweder die vollständige kodierende Sequenz mit der c.2T>C-Mutation oder eine verkürzte kodierende Sequenz beginnend mit dem M166-Codon kodieren (c.A1_A495del). Die Überexpression dieser Konstrukte in Fibroblasten ohne endogenes KDM5C (c.3223delG-Patientenfibroblasten, Abb. 2A) oder in BJ-Kontrollfibroblasten (Ergänzungsmaterial, Abb. S1 B) gefolgt von Western-Blots zeigte, dass Proteine, die von c.2T>C und c.A1_A495del . kodiert werden, KDM5C laufen bei einem ähnlichen Molekulargewicht, was unsere Hypothese stützt. Daten aus der Überexpression von N-terminal markiertem KDM5C mit anderen Patientenmutationen stimmten mit Ergebnissen aus Patientenzellen überein: Die Missense-Mutationen p.P480L und p.D402Y produzieren Protein voller Länge (Fig. 2A, Ergänzungsmaterial, Fig. S1B).

p.M1_E165del KDM5C wird in c.2T>C-Patientenfibroblasten produziert. (EIN) Die Überexpression von KDM5C-Flag-HA in Fibroblasten, denen endogenes KDM5C fehlt, zeigt eine ähnliche Größe von Proteinen aus einem c.2T>C-KDM5C-Expressionsvektor und einem, der bei p.M166 beginnt. Die Überexpression von HA-Flag-KDM5C mit Patientenmutationen bestätigt, dass p.P480L und p.D402Y Missense-Mutationen sind. H514A ist eine katalytische Null-Mutation (13). ACTIN, Ladekontrolle. (B) Die Überexpression von nicht markiertem KDM5C zeigt, dass KDM5C, das bei M166 beginnt, ein ähnliches Molekulargewicht wie endogenes KDM5C in c.2T>C-Patientenfibroblasten aufweist. Die unterste Bande x ist unspezifisch.

p.M1_E165del KDM5C wird in c.2T>C-Patientenfibroblasten produziert. (EIN) Die Überexpression von KDM5C-Flag-HA in Fibroblasten, denen endogenes KDM5C fehlt, zeigt eine ähnliche Größe von Proteinen aus einem c.2T>C-KDM5C-Expressionsvektor und einem, der bei p.M166 beginnt. Die Überexpression von HA-Flag-KDM5C mit Patientenmutationen bestätigt, dass p.P480L und p.D402Y Missense-Mutationen sind. H514A ist eine katalytische Null-Mutation (13). ACTIN, Ladekontrolle. (B) Die Überexpression von nicht markiertem KDM5C zeigt, dass KDM5C, das bei M166 beginnt, ein ähnliches Molekulargewicht wie endogenes KDM5C in c.2T>C-Patientenfibroblasten aufweist. Die unterste Bande x ist unspezifisch.

Wir überexprimierten dann entweder Wildtyp oder c.A1_A495del KDM5C ohne Tags in KDM5C-null-Fibroblasten und verglichen das Molekulargewicht des resultierenden Proteins mit endogenem KDM5C-Protein aus Kontroll- oder c.2T>C-Patientenfibroblasten (Fig. 2B). Wir beobachteten, dass überexprimiertes Wildtyp-KDM5C wie erwartet bei einem ähnlichen Molekulargewicht wie KDM5C in Kontrollfibroblasten läuft. Überexprimiertes c.A1_A495del produziert ein KDM5C-Protein, das ein ähnliches Molekulargewicht wie das endogene KDM5C in c.2T>C-Fibroblasten aufweist, was darauf hindeutet, dass bei diesen Patienten p.M1_E165del produziert wird.

P.M1_E165del KDM5C assoziiert mit Chromatin

Wir untersuchten zuerst, ob das Fehlen der ARID-DNA-Bindungsdomäne (24) die Assoziation von p.M1_E165del KDM5C mit Chromatin verhindert. Um dies zu testen, haben wir überexprimiert KDM5C mit Patientenmutationen oder KDM5C denen entweder die JmjN- oder die ARID-Domäne fehlte, und fraktionierte Zellen in Zytoplasma, Nukleoplasma und Chromatin, bevor sie Western-Blotting für KDM5C erhielten (Fig. 3). Der Verlust weder der JmjN- noch der ARID-Domäne verhindert den Nachweis von KDM5C in der Chromatinfraktion. Das verkürzte p.M1_E165del KDM5C findet sich auch in der Chromatinfraktion (Abb. 3). Die Fraktionierung von c.2T>C-Patientenzelllinien bestätigte die endogene Assoziation mit Chromatin (Ergänzungsmaterial, Fig. S2).

Abgeschnittenes c.2T>C KDM5C kann mit Chromatin assoziieren. Fraktionierung von KDM5C-null Fibroblasten, die KDM5C-Flag-HA überexprimieren, zeigt, dass KDM5C keine JmjN- oder ARID-Domänen für die Chromatin-Assoziation benötigt. TUBULIN (Zytoplasma), P300 (Nukleoplasma) und H3 (Chromatin) Ladekontrollen. Rechtes Panel, Fraktionierungssteuerung.

Abgeschnittenes c.2T>C KDM5C kann mit Chromatin assoziieren. Fraktionierung von KDM5C-null Fibroblasten, die KDM5C-Flag-HA überexprimieren, zeigt, dass KDM5C keine JmjN- oder ARID-Domänen für die Chromatin-Assoziation benötigt. TUBULIN (Zytoplasma), P300 (Nukleoplasma) und H3 (Chromatin) Ladekontrollen. Rechtes Panel, Fraktionierungssteuerung.

Patientenmutationen in KDM5C reduzieren die Proteinstabilität

Die globalen Spiegel des KDM5C-Proteins sind in Patientenfibroblasten im Vergleich zu Kontrollen reduziert ( 1C ), während die RNA-Spiegel vergleichbar sind ( 1B ), was darauf hindeutet, dass Patientenmutationen die KDM5C-Stabilität beeinflussen könnten. Um diese Hypothese direkt zu testen, führten wir Zeitverlaufsanalysen mit dem Translationsinhibitor Cycloheximid an Kontroll- und Patientenfibroblasten durch (Abb. 4). Das KDM5C-Protein ist in Kontrollfibroblasten mit einer Halbwertszeit von mindestens 12 h relativ stabil. Fibroblasten mit der Missense-Mutation p.D402Y haben eine KDM5C-Halbwertszeit von 4 h, während p.P480L KDM5C eine dramatischere Reduktion auf etwa 2 h zeigt. Fibroblasten mit der c.2T>C-Mutation zeigen auch eine drastisch reduzierte Proteinstabilität mit einer Halbwertszeit von 2 h ( 4 ).

Patientenmutationen destabilisieren KDM5C. Cycloheximid (CHX, 100 μg/ml) Zeitverläufe bei Kontroll- und Patientenfibroblasten zeigen, dass KDM5C in Patientenfibroblasten mit c.2T>C-, p.P480L- und p.D402Y-Mutationen weniger stabil ist als KDM5C in Kontrollfibroblasten. TUBULIN, Ladekontrollen.

Patientenmutationen destabilisieren KDM5C. Cycloheximid (CHX, 100 μg/ml) Zeitverläufe bei Kontroll- und Patientenfibroblasten zeigen, dass KDM5C in Patientenfibroblasten mit c.2T>C-, p.P480L- und p.D402Y-Mutationen weniger stabil ist als KDM5C in Kontrollfibroblasten. TUBULIN, Ladekontrollen.

In ähnlicher Weise verläufen Cycloheximid-Zeitverläufe auf KDM5C-null Fibroblasten überexprimieren KDM5C mit unterschiedlichen Mutationen zeigt, dass c.2T>C- und c.A1_A495del-kodierte Proteine ​​wesentlich kürzere Halbwertszeiten aufweisen als Wildtyp-KDM5C (Ergänzungsmaterial, Fig. S3). Interessanterweise wird auch eine Verringerung der Stabilität für KDM5C ohne die JmjN-Domäne beobachtet, aber nicht für KDM5C ohne die ARID-Domäne, was darauf hindeutet, dass das Fehlen der JmjN-Domäne die Stabilität des c.2T>C-Patienten KDM5C verringert (Supplementary Material, Abb .S3)). Dies stimmt mit der Bedeutung der JmjN-Domäne für die Stabilität in anderen JmjC-haltigen Demethylasen überein (25, 26).

Patientenmutationen in KDM5C reduzieren seine Histon-Demethylase-Aktivität

Es wurde gezeigt, dass einige Missense-Mutationen von Patienten, einschließlich p.D402Y, die KDM5C-Demethylase-Aktivität beeinträchtigen ( 13, 14, 17), aber die Wirkung der p.P480L-Mutation wurde nicht untersucht. Darüber hinaus enthält das verkürzte p.M1_E165del KDM5C, das in c.2T>C-Patienten produziert wird, die katalytische Domäne von JmjC, aber es fehlen andere hochkonservierte Domänen, und seine Demethylaseaktivität ist nicht bekannt.

Wir fragten daher, ob Patientenmutationen die Aktivität der KDM5C-Demethylase verringerten in vitro. Wir reinigten Wildtyp-KDM5C und KDM5C, die entweder eine katalytische Null-Mutation [p.H514A] (13) oder Patientenmutationen (p.D402Y, p.P480L, p.M1_E165del) aus Insektenzellen enthielten (Fig. 5A). Wir verwendeten diese gereinigten Proteine ​​in Demethylase-Assays an Histonpeptiden (Fig. 5B) oder an gereinigten Histonen (Fig. 5C) und bewerteten die Ergebnisse entweder unter Verwendung von Massenspektrometrie oder Western-Blot unter Verwendung von Histon-Modifikations-Antikörpern. Es sollte beachtet werden, dass es nicht möglich war, p.M1_E165del auf das gleiche Niveau wie die anderen Konstrukte (Abb. 5A) zu exprimieren und zu reinigen, wahrscheinlich aufgrund der inhärenten Instabilität dieses Proteins, und dies ist eine Einschränkung bei der Beurteilung seiner Demethylaseaktivität .

Missense- und Translations-Neustart-Mutationen reduzieren die Demethylase-Aktivität von KDM5C in vitro. (EIN) Coomassie- und KDM5C-Blots von KDM5C, gereinigt aus Sf9-Insektenzellen und verwendet in Demethylase-Assays an Peptiden (B) oder Histone (C). Wildtyp KDM5C demethyliert H3K4me3 und H3K4me2, die katalytische Nullform von H514A hat keine Aktivität. p.D402Y-, p.P480L- und p.M1_E165del-Mutationen reduzieren die KDM5C-Demethylase-Aktivität.

Missense- und Translations-Neustart-Mutationen reduzieren die Demethylase-Aktivität von KDM5C in vitro. (EIN) Coomassie- und KDM5C-Blots von KDM5C, gereinigt aus Sf9-Insektenzellen und verwendet in Demethylase-Assays an Peptiden (B) oder Histone (C). Wildtyp KDM5C demethyliert H3K4me3 und H3K4me2, die katalytische Nullform von H514A hat keine Aktivität. p.D402Y-, p.P480L- und p.M1_E165del-Mutationen reduzieren die KDM5C-Demethylase-Aktivität.

Wildtyp-KDM5C demethyliert H3K4me2-Peptide zu H3K4me1 und H3K4me3 zu H3K4me2 (Fig. 5B), wie zuvor gesehen (13, 14). Das enzymatisch abgestorbene p.H514A-Protein zeigt keine nachweisbare Demethylaseaktivität auf H3K4me2- oder H3K4me3-Peptiden. Patientenmutationen p.P480L und p.D402Y reduzieren die Demethylaseaktivität sowohl auf H3K4me2- als auch auf H3K4me3-Peptiden im Vergleich zu Wildtyp-KDM5C stark, obwohl sie im Vergleich zur katalytisch-null-Mutante eine Restaktivität zeigen ( 5B ).

Zusätzlich zu Demethylase-Assays mit Histon-Peptiden haben wir getestet, ob KDM5C-Mutationen von Patienten die Demethylase-Aktivität auf gereinigten Histonen verändern, die physiologisch relevantere Substrate sind. Wildtyp-KDM5C demethyliert H3K4me2 und H3K4me3 an gereinigten Histonen, wie zuvor berichtet, führt jedoch zu keinen wesentlichen Veränderungen im Spiegel von H3K4me1, H3K9me3, H3K27me3, H3K36me2 oder H3K36me3 (Fig. 5C). p.H514A katalytisch-null KDM5C demethyliert keine gereinigten Histone auf H3K4me2/3, und p.M1_E165del auch nicht. p.D402Y und p.P480L KDM5C zeigen eine begrenzte Demethylase-Aktivität auf H3K4me2, während die Demethylierung von H3K4me3 durch p.D402Y oder p.P480L mit der von Wildtyp-KDM5C vergleichbar ist. Die Unterschiede in der mutierten KDM5C-Aktivität auf Histone im Vergleich zu Peptiden können auf das Vorhandensein zusätzlicher Modifikationen auf gereinigten Histonen zurückzuführen sein, die mit der H3K4-Methylierung übersprechen können.

Um diese zu ergänzen in vitro Dememethylase-Assays überexprimierten wir KDM5C mit N-terminalen (Fig. 6A) oder C-terminalen (Ergänzungsmaterial, Fig. S4) Tags in Kontrollfibroblasten und bewerteten H3K4me3 auf Einzelzellebene unter Verwendung von Immunfluoreszenzmikroskopie. In Zellen, die hohe Mengen an Wildtyp-KDM5C exprimierten, war die H3K4me3-Färbung deutlich reduziert (Pfeile, Fig. 6A, Ergänzungsmaterial, Fig. S4). Dies war bei Zellen, die hohe Konzentrationen der katalytischen Mutante p.H514A KDM5C exprimierten, nicht der Fall, wobei die Konzentrationen von H3K4me3 über die Zellpopulation unabhängig von ihrem KDM5C-Niveau gleich waren ( 6A , Ergänzungsmaterial, 5 ). Hohe Konzentrationen von p.D402Y induzierten eine Verringerung der H3K4me3-Färbung, während die H3K4me3-Färbung in Zellen, die die p.P480L-, p.M1_E165del- ( 6A ) und c.2T>C (Ergänzungsmaterial, Abb. S4) überexprimierten, stark blieb, was darauf hindeutet, dass diese Mutationen reduzieren die KDM5C-Aktivität in vivo. JmjN- und ARID-Domänen sind beide für die Demethylaseaktivität erforderlich (Ergänzungsmaterial, Fig. S4).

p.P480L und p.M1_E165del KDM5C haben eine beeinträchtigte Demethylaseaktivität Ex-vivound Patientenfibroblasten zeigen lokale Genexpressionsänderungen. (EIN) HA-Flag-KDM5C mit verschiedenen Patientenmutationen wurde in Kontroll-BJ-Fibroblasten überexprimiert und die Spiegel von KDM5C (Flag) und H3K4me3 wurden durch Immunfluoreszenz bestimmt. Zellen mit hohem WT oder p.D402Y KDM5C zeigten eine reduzierte H3K4me3-Färbung, was eine Demethylaseaktivität demonstrierte. Die Überexpression von p.H514A, p.P480L und p.M1_E165del KDM5C reduzierte die H3K4me3-Spiegel nicht. Pfeile, Zellen, die markiertes KDM5C in hohen Konzentrationen exprimieren. (B) Saure Histonextrakte aus Hautfibroblasten von Patienten zeigen keine konsistente Veränderung der globalen H3K4-Methylierung. H3, Ladekontrolle. (C) Veränderungen der Genexpression in Patientenfibroblasten im Vergleich zu Kontrollen. Mittelwert und Standardabweichung von drei unabhängigen Experimenten werden angezeigt (*P < 0,05 im Vergleich zu Kontrolle-1, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Control-1.

p.P480L und p.M1_E165del KDM5C haben eine beeinträchtigte Demethylaseaktivität Ex-vivound Patientenfibroblasten zeigen lokale Genexpressionsänderungen. (EIN) HA-Flag-KDM5C mit verschiedenen Patientenmutationen wurde in Kontroll-BJ-Fibroblasten überexprimiert und die Spiegel von KDM5C (Flag) und H3K4me3 wurden durch Immunfluoreszenz bestimmt. Zellen mit hohem WT oder p.D402Y KDM5C zeigten eine reduzierte H3K4me3-Färbung, was eine Demethylaseaktivität demonstrierte. Die Überexpression von p.H514A, p.P480L und p.M1_E165del KDM5C reduzierte die H3K4me3-Spiegel nicht. Pfeile, Zellen, die markiertes KDM5C in hohen Konzentrationen exprimieren. (B) Saure Histonextrakte aus Hautfibroblasten von Patienten zeigen keine konsistente Veränderung der globalen H3K4-Methylierung. H3, Ladekontrolle. (C) Veränderungen der Genexpression in Patientenfibroblasten im Vergleich zu Kontrollen. Mittelwert und Standardabweichung von drei unabhängigen Experimenten werden angezeigt (*P < 0,05 im Vergleich zu Kontrolle-1, Student's T-Prüfung). RNA wurde unter Verwendung von Primern nachgewiesen, die Exon-Exon-Verbindungen überspannen, und auf das Housekeeping-Gen normalisiert RSP18 und dann Control-1.

Fibroblasten von Patienten zeigen lokalisierte Veränderungen der Genexpression, aber keine globalen Veränderungen der Histonmethylierung

Der gesamte zelluläre Histonmethylierungsspiegel wird durch mehrere verschiedene Methyltransferasen und Demethylasen bestimmt. Um die Wirkung einer reduzierten KDM5C-Aktivität bei Patienten (Abb. 5 und 6A) auf die globale Histonmethylierung zu beurteilen in vivo, extrahierten wir Histone aus Patienten- und Kontrollfibroblasten. Western Blots zeigten keine konsistente Veränderung der H3K4-Methylierung in Patientenfibroblasten im Vergleich zu Kontrollen, was darauf hindeutet, dass KDM5C Mutationen bestimmen nicht die globalen Niveaus der H3K4-Methylierung ( 6B ).

Veränderte Genexpressionsmuster in XLID erfordern nicht unbedingt eine globale Änderung der Histonmethylierung, sondern können aus lokalisierten Veränderungen an bestimmten Loci resultieren. Dies steht im Einklang mit einer erhöhten Expression ( 27) oder einer reduzierten DNA-Methylierung ( 22) bei bestimmten Genen in lymphoblastoiden Zelllinien und Blut von Patienten mit KDM5C Mutationen im Vergleich zu Kontrollen. Wir testeten diese zuvor identifizierten Gene auf Expressionsänderungen in Patientenfibroblasten im Vergleich zu Kontrollen unter Verwendung von qRT-PCR ( 6C ). Wir fanden drei Gene, die in Patientenfibroblasten im Vergleich zu Kontrollen eine signifikante Hochregulierung zeigten: EMILIN2 (Elastin-Mikrofibrillen-Schnittstelle 2), TNFSF4 [Tumornekrosefaktor (Ligand) Superfamilienmitglied 4] und ZMYND12 (Zinkfinger MYND-Typ mit 12). Diese Ergebnisse unterstützen die Idee von XLID-assoziierten lokalen Veränderungen der H3K4-Methylierungsmuster und der Genexpression in Patientenzellen.


Verweise

Kryshtafovych A, Fidelis K, Mauser J: Fortschritt von CASP6 zu CASP7. Proteine. 2007, 69 (Beilage 8): 194-207. 10.1002/Prot.21769.

Grabowski M, Joachimiak A, Otwinowski Z, Minor W: Strukturelle Genomik: Schritt halten mit dem wachsenden Wissen über das Proteinuniversum. Curr Opin Struct Biol. 2007, 17: 347-353. 10.1016/j.sbi.2007.06.003.

Reeves GA, Thornton JM: Integration biologischer Daten durch das Genom. Hum Mol Genet. 2006, 15 (Spezifikation Nr. 1): R81-R87. 10.1093/hmg/ddl086.

Prlic A, Down TA, Kulesha E, Finn RD, Kahari A, Hubbard TJ: Integration von Sequenz- und Strukturbiologie mit DAS. BMC Bioinformatik.2007, 8: 333-10.1186/1471-2105-8-333.

Tramontano A: Die Rolle der Molekularmodellierung in der biomedizinischen Forschung. FEBS Lett. 2006, 580: 2928-2934. 10.1016/j.febslet.2006.04.011.

Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G: Genontologie: Werkzeug zur Vereinheitlichung der Biologie. Das Genontologie-Konsortium. Nat Genet. 2000, 25: 25-29. 10.1038/75556.

Tress M, Cheng J, Baldi P, Joo K, Lee J, Seo JH, Lee J, Baker D, Chivian D, Kim D, Ezkurdia I: Bewertung der für die CASP7-Domänenvorhersagekategorie eingereichten Vorhersagen. Proteine. 2007, 69 (Beilage 8): 137-151. 10.1002/Prot.21675.

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Einfaches lokales Alignment-Suchwerkzeug. J. Mol. Biol. 1990, 215: 403-410.

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST und PSI-BLAST: eine neue Generation von Proteindatenbank-Suchprogrammen. Nukleinsäuren Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.

Wu CH, Nikolskaya A, Huang H, Yeh LS, Natale DA, Vinayaka CR, Hu ZZ, Mazumder R, Kumar S, Kourtesis P, Ledley RS, Suzek BE, Arminski L, Chen Y, Zhang J, Cardenas JL, Chung S , Castro-Alvear J, Dinkov G, Barker WC: PIRSF: Familienklassifikationssystem bei der Protein Information Resource. Nukleinsäuren Res. 2004, D112-D114. 10.1093/nar/gkh097. 32 Datenbank

Reid AJ, Yeats C, Orengo CA: Methoden der Fernhomologieerkennung können kombiniert werden, um die Abdeckung in der Mitternachtszone um 10 % zu erhöhen. Bioinformatik. 2007, 23: 2353-2360. 10.1093/Bioinformatik/btm355.

Apic G, Gough J, Teichmann SA: Domänenkombinationen in archaealen, eubakteriellen und eukaryotischen Proteomen. J. Mol. Biol. 2001, 310: 311-325. 10.1006/jmbi.2001.4776.

Marchler-Bauer A, Anderson JB, Derbyshire MK, DeWeese-Scott C, Gonzales NR, Gwadz M, Hao L, He S, Hurwitz DI, Jackson JD, Ke Z, Krylov D, Lanczycki CJ, Liebert CA, Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Thanki N, Yamashita RA, Yin JJ, Zhang D, Bryant SH: CDD: eine konservierte Domänendatenbank für die interaktive Domänenfamilienanalyse. Nukleinsäuren Res. 2007, D237-D240. 10.1093/nar/gkl951. 35 Datenbank

Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C, Langendijk-Genevaux PS, Sigrist CJ: The 20 years of PROSITE. Nukleinsäuren Res. 2008, D245-D249. 36 Datenbank

Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, Ceric G, Forslund K, Eddy SR, Sonnhammer EL, Bateman A: Die Datenbank der Pfam Proteinfamilien. Nukleinsäuren Res. 2008, D281-D288. 36 Datenbank

Letunic I, Copley RR, Pils B, Pinkert S, Schultz J, Bork P: SMART 5: Domänen im Kontext von Genomen und Netzwerken. Nukleinsäuren Res. 2006, D257-D260. 10.1093/nar/gkj079. 34 Datenbank

Die universelle Proteinquelle (UniProt). Nukleinsäuren Res. 2008, D190-D195. 36 Datenbank

Mulder NJ, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Buillard V, Cerutti L, Copley R, Courcelle E, Das U, Daugherty L, Dibley M, Finn R, Fleischmann W, Gough J , Haft D, Hulo N, Hunter S, Kahn D, Kanapin A, Kejariwal A, Labarga A, Langendijk-Genevaux PS, Lonsdale D, Lopez R, Letunic I, Madera M, Maslen J, et al.: Neue Entwicklungen im InterPro Datenbank. Nukleinsäuren Res. 2007, D224-D228. 10.1093/nar/gkl841. 35 Datenbank

Yeats C, Lees J, Reid A, Kellam P, Martin N, Liu X, Orengo C: Gene3D: umfassende strukturelle und funktionelle Annotation von Genomen. Nukleinsäuren Res. 2008, D414-D418. 36 Datenbank

Wilson D, Madera M, Vogel C, Chothia C, Gough J: Die SUPERFAMILY-Datenbank im Jahr 2007: Familien und Funktionen. Nukleinsäuren Res. 2007, D308-D313. 10.1093/nar/gkl910. 35 Datenbank

Orengo CA, Michie AD, Jones S, Jones DT, Swindells MB, Thornton JM: CATH - eine hierarchische Klassifizierung von Proteindomänenstrukturen. Struktur. 1997, 5: 1093-1108. 10.1016/S0969-2126(97)00260-8.

Murzin AG, Brenner SE, Hubbard T, Chothia C: SCOP: eine Datenbank zur strukturellen Klassifizierung von Proteinen zur Untersuchung von Sequenzen und Strukturen. J. Mol. Biol. 1995, 247: 536–540. 10.1006/jmbi.1995.0159.

Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA : Die COG-Datenbank: eine aktualisierte Version enthält Eukaryoten. BMC Bioinformatik. 2003, 4: 41-10.1186/1471-2105-4-41.

Kaplan N, Sasson O, Inbar U, Friedlich M, Fromer M, Fleischer H, Portugaly E, Linial N, Linial M: ProtoNet 4.0: eine hierarchische Klassifizierung von einer Million Proteinsequenzen. Nukleinsäuren Res. 2005, D216-D218. 33 Datenbank

Petryszak R, Kretschmann E, Wieser D, Apweiler R: Die Vorhersagekraft der CluSTr-Datenbank. Bioinformatik. 2005, 21: 3604-3609. 10.1093/bioinformatik/bti542.

Krause A, Stoye J, Vingron M: Hierarchisches Clustering von Proteinsequenzen im großen Maßstab. BMC Bioinformatik. 2005, 6: 15-10.1186/1471-2105-6-15.

Bru C, Courcelle E, Carrere S, Beausse Y, Dalmar S, Kahn D: Die ProDom-Datenbank der Proteindomänenfamilien: mehr Betonung auf 3D. Nukleinsäuren Res. 2005, D212-D215. 33 Datenbank

Portugaly E, Linial N, Linial M: EVEREST: eine Sammlung evolutionär konservierter Proteindomänen. Nukleinsäuren Res. 2007, D241-D246. 10.1093/nar/gkl850. 35 Datenbank

Watson JD, Sanderson S, Ezersky A, Savchenko A, Edwards A, Orengo C, Joachimiak A, Laskowski RA, Thornton JM: Auf dem Weg zur vollautomatischen strukturbasierten Funktionsvorhersage in der strukturellen Genomik: eine Fallstudie. J. Mol. Biol. 2007, 367: 1511-1522. 10.1016/j.jmb.2007.01.063.

Chothia C, Lesk AM: Die Beziehung zwischen der Divergenz von Sequenz und Struktur in Proteinen. EMBO J. 1986, 5: 823–826.

Taylor WR, Orengo CA: Ausrichtung der Proteinstruktur. J. Mol. Biol. 1989, 208: 1-22. 10.1016/0022-2836(89)90084-3.

Redfern OC, Harrison A, Dallman T, Pearl FM, Orengo CA: CATHEDRAL: ein schneller und effektiver Algorithmus zur Vorhersage von Faltungen und Domänengrenzen aus Multidomänen-Proteinstrukturen. PLoS Comput Biol. 2007, 3: e232-10.1371/journal.pcbi.0030232.

Holm L, Sander C: Proteinstrukturvergleich durch Ausrichtung von Distanzmatrizen. J. Mol. Biol. 1993, 233: 123-138. 10.1006/jmbi.1993.1489.

Krissinel E, Henrick K: Sekundärstruktur-Matching (SSM), ein neues Werkzeug für die schnelle Ausrichtung von Proteinstrukturen in drei Dimensionen. Acta Crystallogr D Biol Crystallogr. 2004, 60: 2256-2268. 10.1107/S0907444904026460.

Madej T, Gibrat JF, Bryant SH: Threading einer Datenbank von Proteinkernen. Proteine. 1995, 23: 356-369. 10.1002/Prot.340230309.

Shindyalov IN, Bourne PE: Proteinstruktur-Alignment durch inkrementelle kombinatorische Erweiterung (CE) des optimalen Pfades. Protein Eng. 1998, 11: 739-747. 10.1093/Protein/11.9.739.

Kolodny R, Koehl P, Levitt M: Umfassende Bewertung von Proteinstruktur-Alignment-Methoden: Scoring durch geometrische Maßnahmen. J. Mol. Biol. 2005, 346: 1173-1188. 10.1016/j.jmb.2004.12.032.

Ye Y, Godzik A: Flexible Strukturausrichtung durch Verkettung ausgerichteter Fragmentpaare, die Drehungen ermöglichen. Bioinformatik. 2003, 19 (Beilage 2): ii246-255.

Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: The Protein Data Bank. Nukleinsäuren Res. 2000, 28: 235-242. 10.1093/nar/28.1.235.

Polacco BJ, Babbitt PC: Automatisierte Entdeckung von 3D-Motiven für die Annotation von Proteinfunktionen. Bioinformatik. 2006, 22: 723-730. 10.1093/Bioinformatik/btk038.

Kleywegt GJ: Erkennung räumlicher Motive in Proteinstrukturen. J. Mol. Biol. 1999, 285: 1887-1897. 10.1006/jmbi.1998.2393.

Wangikar PP, Tendulkar AV, Ramya S, Mali DN, Sarawagi S: Funktionelle Stellen in Proteinfamilien aufgedeckt durch einen objektiven und automatisierten graphentheoretischen Ansatz. J. Mol. Biol. 2003, 326: 955-978. 10.1016/S0022-2836(02)01384-0.

Laskowski RA, Luscombe NM, Swindells MB, Thornton JM: Proteinspalten in der molekularen Erkennung und Funktion. Protein Sci. 1996, 5: 2438–2452.

Laskowski RA: SURFNET: ein Programm zur Visualisierung von molekularen Oberflächen, Hohlräumen und intermolekularen Wechselwirkungen. J Mol Graph. 1995, 13: 323-330. 10.1016/0263-7855(95)00073-9.

Landau M, Mayrose I, Rosenberg Y, Glaser F, Martz E, Pupko T, Ben-Tal N: ConSurf 2005: die Projektion von evolutionären Erhaltungswerten von Resten auf Proteinstrukturen. Nukleinsäuren Res. 2005, 33: W299-W302. 10.1093/nar/gki370.

Glaser F, Rosenberg Y, Kessel A, Pupko T, Ben-Tal N: Die ConSurf-HSSP-Datenbank: die Kartierung der evolutionären Erhaltung unter Homologen auf PDB-Strukturen. Proteine. 2005, 58: 610-617. 10.1002/Prot.20305.

Binkowski TA, Freeman P, Liang J: pvSOAR: Nachweis ähnlicher Oberflächenmuster von Taschen- und Hohlraumoberflächen von Aminosäureresten auf Proteinen. Nukleinsäuren Res. 2004, 32: W555-W558. 10.1093/nar/gkh390.

Dundas J, Ouyang Z, Tseng J, Binkowski A, Turpaz Y, Liang J: CASTp: berechneter Atlas der Oberflächentopographie von Proteinen mit struktureller und topographischer Kartierung von funktionell annotierten Resten. Nukleinsäuren Res. 2006, 34: W116-W118. 10.1093/nar/gkl282.

Bagley SC, Altman RB: Charakterisierung der Mikroumgebung, die Proteinstellen umgibt. Protein Sci. 1995, 4: 622-635.

Shulman-Peleg A, Nussinov R, Wolfson HJ: SiteEngines: Erkennung und Vergleich von Bindungsstellen und Protein-Protein-Schnittstellen. Nukleinsäuren Res. 2005, 33: W337-W341. 10.1093/nar/gki482.

Sasin JM, Godzik A, Bujnicki JM: SURF'S UP! - Proteinklassifizierung durch Oberflächenvergleiche. J Biosci. 2007, 32: 97-100. 10.1007/s12038-007-0009-0.

Porter CT, Bartlett GJ, Thornton JM: The Catalytic Site Atlas: eine Ressource von katalytischen Zentren und Resten, die in Enzymen anhand von Strukturdaten identifiziert wurden. Nukleinsäuren Res. 2004, 32: D129-D133. 10.1093/nar/gkh028.

Ivanisenko VA, Pintus SS, Grigorovich DA, Kolchanov NA: PDBSiteScan: ein Programm zur Suche nach aktiven, bindenden und posttranslationalen Modifikationsstellen in den 3D-Strukturen von Proteinen. Nukleinsäuren Res. 2004, 32: W549-W554. 10.1093/nar/gkh439.

Ivanisenko VA, Pintus SS, Grigorovich DA, Kolchanov NA: PDBSite: eine Datenbank der 3D-Struktur von Proteinfunktionsstellen. Nukleinsäuren Res. 2005, 33: D183-D187. 10.1093/nar/gki105.

George RA, Spriggs RV, Bartlett GJ, Gutteridge A, MacArthur MW, Porter CT, Al-Lazikani B, Thornton JM, Swindells MB: Effektive Funktionsannotation durch katalytische Resterhaltung. Proc Natl Acad Sci USA. 2005, 102: 12299-12304. 10.1073/pnas.0504833102.

Laskowski RA, Watson JD, Thornton JM: ProFunc: ein Server zur Vorhersage der Proteinfunktion aus der 3D-Struktur. Nukleinsäuren Res. 2005, 33: W89-W93. 10.1093/nar/gki414.

Stark A, Russell RB: Annotation in drei Dimensionen. PINTS: Muster in nicht-homologen Tertiärstrukturen. Nukleinsäuren Res. 2003, 31: 3341-3344. 10.1093/nar/gkg506.

Lichtarge O, Bourne HR, Cohen FE: Eine evolutionäre Spurenmethode definiert Bindungsoberflächen, die Proteinfamilien gemeinsam sind. J. Mol. Biol. 1996, 257: 342-358. 10.1006/jmbi.1996.0167.

Kristensen DM, Ward RM, Lisewski AM, Erdin S, Chen BY, Fofanov VY, Kimmel M, Kavraki LE, Lichtarge O: Vorhersage der Enzymfunktion basierend auf 3D-Templaten evolutionär wichtiger Aminosäuren. BMC Bioinformatik. 2008, 9: 17-10.1186/1471-2105-9-17.

Ward RM, Erdin S, Tran TA, Kristensen DM, Lisewski AM, Lichtarge O: De-Orphaning des strukturellen Proteoms durch reziproken Vergleich evolutionär wichtiger Strukturmerkmale. Plus eins. 2008, 3: e2136-10.1371/journal.pone.0002136.

Herrgard S, Cammer SA, Hoffman BT, Knutson S, Gallina M, Speir JA, Fetrow JS, Baxter SM: Vorhersage der schädlichen funktionellen Auswirkungen von Aminosäuremutationen unter Verwendung einer Bibliothek strukturbasierter Funktionsdeskriptoren. Proteine. 2003, 53: 806-816. 10.1002/Prot.10458.

Pal D, Eisenberg D: Rückschluss der Proteinfunktion aus der Proteinstruktur. Struktur. 2005, 13: 121-130. 10.1016/j.str.2004.10.015.

Salwinski L, Miller CS, Smith AJ, Pettit FK, Bowie JU, Eisenberg D: The Database of Interacting Proteins: 2004 Update. Nukleinsäuren Res. 2004, 32: D449-D451. 10.1093/nar/gkh086.

Friedberg I, Harder T, Godzik A: JAFA: ein Metaserver für die Annotation von Proteinfunktionen. Nukleinsäuren Res. 2006, 34: W379-W381. 10.1093/nar/gkl045.

von Mering C, Krause R, Snel B, Cornell M, Oliver SG, Fields S, Bork P: Vergleichende Bewertung großer Datensätze von Protein-Protein-Interaktionen. Natur. 2002, 417: 399-403. 10.1038/natur750.

P Pagel, S. Kovac, M. Oesterheld, B. Brauner, I. Dunger-Kaltenbach, G. Frishman, C. Montrone, P. Mark, V. Stümpflen, HW Mewes, A. Ruepp, D. Frishman: The MIPS Säugetierprotein-Protein-Interaktionsdatenbank. Bioinformatik. 2005, 21: 832-834. 10.1093/Bioinformatik/bti115.

Hart GT, Ramani AK, Marcotte EM: Wie vollständig sind aktuelle Hefe- und Humanprotein-Interaktionsnetzwerke?. Genom Biol. 2006, 7: 120-10.1186/gb-2006-7-11-120.

Aloy P, Russell RB: Zehntausend Interaktionen für den Molekularbiologen. Nat. Biotechnologie. 2004, 22: 1317-1321. 10.1038/nbt1018.

Finn RD, Marshall M, Bateman A: iPfam: Visualisierung von Protein-Protein-Wechselwirkungen in PDB bei Domänen- und Aminosäureauflösungen. Bioinformatik. 2005, 21: 410-412. 10.1093/Bioinformatik/bti011.

Stein A, Russell RB, Aloy P: 3did: interagierende Proteindomänen bekannter dreidimensionaler Struktur. Nukleinsäuren Res. 2005, 33: D413-D417. 10.1093/nar/gki037.

Riley R, Lee C, Sabatti C, Eisenberg D: Ableiten von Proteindomäneninteraktionen aus Datenbanken interagierender Proteine. Genom Biol. 2005, 6: R89-10.1186/gb-2005-6-10-r89.

Jothi R, Cherukuri PF, Tasneem A, Przytycka TM: Die koevolutionäre Analyse von Domänen in interagierenden Proteinen liefert Einblicke in Domänen-Domänen-Interaktionen, die Protein-Protein-Interaktionen vermitteln. J. Mol. Biol. 2006, 362: 861-875. 10.1016/j.jmb.2006.07.072.

Pagel P, Wong P, Frishman D: Eine Domäneninteraktionskarte basierend auf phylogenetischem Profiling. J. Mol. Biol. 2004, 344: 1331-1346. 10.1016/j.jmb.2004.10.019.

Pagel P, Oesterheld M, Tovstukhina O, Strack N, Stumpflen V, Frishman D: DIMA 2.0 – vorhergesagte und bekannte Domäneninteraktionen. Nukleinsäuren Res. 2008, D651-D655. 36 Datenbank

Raghavachari B, Tasneem A, Przytycka TM, Jothi R: DOMINE: eine Datenbank von Proteindomänen-Interaktionen. Nukleinsäuren Res. 2008, D656-D661. 36 Datenbank

Moult J, Pedersen JT, Judson R, Fidelis K: Ein groß angelegtes Experiment zur Bewertung von Methoden zur Vorhersage der Proteinstruktur. Proteine. 1995, 23: ii-v. 10.1002/Prot.340230303.

Soro S, Tramontano A: Die Vorhersage der Proteinfunktion bei CASP6. Proteine. 2005, 61 (Beilage 7): 201-213. 10.1002/Prot.20738.

Pellegrini-Calace M, Soro S, Tramontano A: Überprüfung der Vorhersage der Proteinfunktion bei CASP6. FEBS J. 2006, 273: 2977-2983. 10.1111/j.1742-4658.2006.05309.x.


6 Definitionen

Die folgenden Definitionen sollen dem Benutzer helfen, zu verstehen, was genannt wird, und um die Prinzipien zu verstehen, die diesen Richtlinien zugrunde liegen.

6.1 Gen

Ein Gen ist eine funktionelle Einheit, die normalerweise für ein Protein oder eine RNA kodiert und deren Vererbung experimentell verfolgt werden kann. Die Vererbung wird normalerweise in genetischen Kreuzungen untersucht, aber die Identifizierung des Gens in zytogenetischen oder physikalischen Karten sind andere Mittel zur Kartierung des Genortes. Die Existenz eines Gens kann auch ohne jegliche genetische oder physikalische Karteninformation, wie beispielsweise aus einer cDNA-Sequenz, abgeleitet werden.

6.2 Pseudogen

Eine Sequenz, die einem bekannten funktionellen Gen an einem anderen Locus innerhalb eines Genoms sehr ähnlich ist, das aufgrund von (normalerweise mehreren) Mutationen, die entweder seine Transkription oder Translation (oder beides) verhindern, nicht funktionsfähig ist. Im Allgemeinen resultieren Pseudogene entweder aus der reversen Transkription eines Transkripts ihres "normalen" Paralogs (in diesem Fall fehlen dem Pseudogen typischerweise Introns und es enthält einen Poly(A)-Schwanz, der oft als prozessierte Pseudogene bezeichnet wird) oder durch Rekombination (in diesem Fall ist das Pseudogen typischerweise eine Tandem-Duplizierung seines "normalen" Paralogs). Beachten Sie, dass bei Maus und Ratte ein Gen in einem Inzuchtstamm ein Pseudogen sein kann, in einem anderen jedoch nicht.

6.3 Ort

Ein Locus ist ein Punkt im Genom, identifiziert durch einen Marker, der auf irgendeine Weise kartiert werden kann. Es muss nicht unbedingt einem Gen entsprechen, es könnte beispielsweise ein anonymer nicht-kodierender DNA-Abschnitt oder ein zytogenetisches Merkmal sein. Ein einzelnes Gen kann mehrere Loci enthalten (jeweils durch unterschiedliche Marker definiert) und diese Marker können in genetischen oder physikalischen Kartierungsexperimenten getrennt werden. In solchen Fällen ist es nützlich, diese verschiedenen Loci zu definieren, aber normalerweise sollte der Genname verwendet werden, um das Gen selbst zu bezeichnen, da dies normalerweise die meisten Informationen liefert.

6.4 Markierung

Ein Marker ist das Mittel, mit dem ein Gen oder ein Locus identifiziert wird. Der Marker hängt von einem Assay ab, der beispielsweise die Identifizierung eines mutierten Phänotyps oder das Vorhandensein einer Enzymaktivität, einer Proteinbande oder eines DNA-Fragments sein könnte. Der Assay muss die genetische Variation des Markers zeigen, um den Locus auf einer genetischen Karte abzubilden, aber nicht, um ihn auf einer physischen Karte zu platzieren.

6.5 Allel

Die beiden Kopien eines autosomalen Gens oder Locus auf den mütterlichen und väterlichen Chromosomen sind Allele. Wenn die beiden Allele identisch sind, ist das Tier an diesem Locus homozygot. Wenn genetisch vererbte Varianten eines Gens oder Locus auf irgendeine Weise nachweisbar sind, ermöglichen die verschiedenen Allele eine genetische Kartierung. Ein einzelnes Chromosom kann nur ein einziges Allel tragen und ein Tier trägt außer bei Duplikation, Deletion oder Trisomie zwei autosomale Allele. Insbesondere ist ein zufällig in das Genom eingefügtes Transgen kein Allel des endogenen Locus, der Zustand wird als hemizygot bezeichnet, wenn das Transgen nur in einem der beiden elterlichen Chromosomensätze vorhanden ist. Im Gegensatz dazu ist ein Gen, das durch Targeting auf den endogenen Locus modifiziert wurde, ein Allel und sollte als solches bezeichnet werden.

6.6 Allelvariante

Allelvarianten sind Unterschiede zwischen Allelen, die mit jedem Assay nachweisbar sind. Unterschiede in anonymen DNA-Sequenzen können beispielsweise als einfacher Sequenzlängenpolymorphismus (SSLP) oder als Einzelnukleotidpolymorphismus (SNPs) nachgewiesen werden. Andere Arten von Varianten umfassen Unterschiede im Molekulargewicht oder der Ladung des Proteins, Unterschiede in der Enzymaktivität oder Unterschiede in der einzelsträngigen Konformation (SSCP). Viele allelische Varianten, insbesondere DNA-Varianten, verleihen dem Tier keinen externen Phänotyp. Diese Varianten werden oft als "Polymorphismen" bezeichnet, obwohl dieser Begriff streng genommen nur für Varianten mit einer Häufigkeit von mehr als 1% in der Bevölkerung gilt.

6.7 Spleißvariante oder alternativer Spleiß

Alternatives Spleißen eines Gens führt zu unterschiedlichen, normalerweise vorkommenden Formen von mRNA, die definiert werden, durch welche Exons (oder Teile von Exons) verwendet werden. Somit können ein oder mehrere alternative Proteinprodukte durch ein einzelnes Allel eines Gens produziert werden.Unter den verschiedenen Allelen können sich alternative Spleißformen unterscheiden oder nicht, abhängig davon, ob der Sequenzunterschied zwischen den Allelen den normalen Spleißmechanismus beeinflusst und zu Unterschieden in der Exon- (oder teilweisen Exon-) Verwendung führt. Zum Beispiel kann Allel A mRNAs der Spleißform 1, 2 und 3 produzieren, während Allel B mRNAs der Spleißform 1, 2 und 4 produzieren kann und Allel C mRNAs der Spleißform 1, 2 und 3 produzieren kann In diesem Fall muss sich jedes der Allele A, B und C definitionsgemäß in seiner DNA-Sequenz unterscheiden. Der Unterschied zwischen Allel B und Allel A und C muss jedoch einen Sequenzunterschied beinhalten, der das Spleißmuster des Gens beeinflusst.

6.8 Mutation

Eine Mutation ist eine bestimmte Klasse von Allelvarianten, die normalerweise einen phänotypisch identifizierbaren Unterschied zu einem Referenz-"Wildtyp"-Phänotyp verleiht. In einigen Fällen, beispielsweise wenn homologe Rekombination verwendet wird, um auf ein Gen abzuzielen, kann jedoch kein leicht identifizierter Phänotyp resultieren, selbst wenn das Gen funktionsunfähig gemacht wird. In solchen Fällen werden die anvisierten Gene dennoch als mutierte Allele bezeichnet.

6.9 Dominant und rezessiv

Dominant und rezessiv beziehen sich auf die Art der Vererbung von Phänotypen, nicht auf Gene, Allele oder Mutationen. Ein rezessiver Phänotyp ist ein Phänotyp, der nur erkannt wird, wenn beide Allele eine bestimmte Variante oder Mutation aufweisen. Ein dominanter Phänotyp ist nachweisbar, wenn nur eine Allelvariante vorhanden ist. Können beide Allele gleichzeitig durch einen Assay nachgewiesen werden, dann sind sie kodominant. Zum Beispiel wird ein Assay, der Variationen von DNA oder Protein erkennt, fast immer eine kodominante Vererbung erkennen, da beide Allele erkannt werden. Wenn eine Mutation einen Phänotyp im Heterozygoten erzeugt, der zwischen dem homozygoten Normal und der Mutante liegt, wird der Phänotyp als semidominant bezeichnet. Eine einzelne Mutation kann sowohl einen dominanten als auch einen rezessiven Phänotyp verleihen. Zum Beispiel der Maus-Patch (Ph)-Mutation hat einen heterozygoten (dominanten) Pigmentierungsphänotyp, aber auch einen homozygoten (rezessiven) letalen Phänotyp. Da die Begriffe auf Phänotypen und nicht auf Gene oder Allele angewendet werden, kann in dem Fall, in dem ein Gen mehrere mutierte Allele aufweist, jedes einen Phänotyp verleihen, der für einige Phänotypen dominant, für andere jedoch aufgrund anderer Allele rezessiv ist.

Die Penetranz ist ein quantitatives Maß dafür, wie oft der Phänotyp in einer Population auftritt, und die Expressivität ist ein Maß dafür, wie stark ein Phänotyp in einem Individuum exprimiert wird. Insbesondere bei segregierenden Kreuzungen oder wenn es einen Schwellenwerteffekt auf die phänotypische Manifestation gibt, bieten diese Messungen zusätzliche Möglichkeiten, um zu beschreiben, wie bestimmte Allelkombinationen zu einem Phänotyp führen.

6.10 Genotyp

Genotyp ist die Beschreibung der genetischen Zusammensetzung der Tiere, normalerweise in Form von bestimmten Allelen an bestimmten Loci. Es kann sich auf einzelne Gene oder Loci oder auf viele beziehen. Der Genotyp kann nur durch die Untersuchung des Phänotyps bestimmt werden, einschließlich der Testpaarung, um Träger rezessiver Mutationen aufzudecken. Streng genommen prüft sogar die direkte Bestimmung von DNA-Varianten den Phänotyp und nicht den Genotyp, da er von einem bestimmten Assay abhängt, obwohl er dem Genotyp so nahe kommt, dass er als Surrogat dient.

6.11 Phänotyp

Der Phänotyp ist das Ergebnis der Wechselwirkung zwischen Genotyp und Umwelt und kann durch jeden Assay bestimmt werden.

6.12 Quantitative Trait Loci (QTLs)

Quantitative Trait Loci (QTL) sind polymorphe Loci, die Allele enthalten, die die Expression kontinuierlich verteilter phänotypischer Merkmale unterschiedlich beeinflussen. Gewöhnlich sind dies Marker, die durch statistische Assoziation mit quantitativer Variation in den bestimmten phänotypischen Merkmalen beschrieben werden, die durch die kumulative Wirkung von Allelen an mehreren Loci kontrolliert werden.

6.13 Haplotyp

Ein Haplotyp ist die Assoziation genetisch verbundener Allele, wie sie in einem Gameten gefunden werden. Sie können eine Kombination jeglicher Art von Markern sein und können sich über große, genetisch trennbare Distanzen erstrecken oder innerhalb einer kurzen Distanz, wie innerhalb eines Gens und normalerweise nicht getrennt sein.

6.14 Homolog

Gene sind homolog, wenn sie erkennbar aus einem gemeinsamen Vorfahren hervorgegangen sind. Beachten Sie, dass Gene entweder homolog sind oder nicht, es gibt keine Homologiegrade! Zum Beispiel sind alle Globin-Gene und Myoglobin Homologe, obwohl einige enger miteinander verwandt sind als andere. Wenn ein Maß für die Verwandtschaft zwischen Sequenzen erforderlich ist, sollte die prozentuale Identität oder Ähnlichkeit verwendet werden.

6.15 Ortholog

Gene in verschiedenen Arten sind Orthologe, wenn sie sich aus einem einzigen gemeinsamen Vorfahren-Gen entwickelt haben. Beispielsweise sind die Beta-Globin-Gene von Maus, Ratte und Mensch Orthologe. Beachten Sie, dass mehrere Gene in der Maus oder Ratte in einer anderen Spezies ein einziges Orthologe haben können und umgekehrt.

6.16 Paralog

Paraloge Gene sind Gene innerhalb derselben Art, die durch Duplikation und anschließende Divergenz aus einem gemeinsamen Vorfahren hervorgegangen sind. Zum Beispiel sind die Alpha-Globin- und Beta-Globin-Gene der Maus Paraloge.


Struktur der APOB Gen/APOB mRNA-Bearbeitung

Beim erwachsenen Menschen wird ApoB-100 in der Leber (4536 Aminosäuren 100%) und ApoB-48 im Darm (2152 Aminosäuren 48%) über einen einzigartigen mRNA-Editierungsprozess produziert (1). Die 43-kb APOB Das Gen befindet sich auf dem kurzen Arm des menschlichen Chromosoms 2. Es besteht aus 29 Exons, von denen Exon 26 mit 7572 bp das größte ist und mehr als die Hälfte des Vollproteins kodiert. Ein neuer posttranskriptioneller Editierprozess, der an der 14,5-kb-mRNA abläuft, führt zur Produktion von apoB-48. Kurz gesagt, eine RNA-spezifische Cytidin-Deaminase, apoB mRNA-Editing-Enzym-Katalysator-Komplex 1 (Apobec-1), bindet an das Cytosin-Molekül an der Base 6666 der mRNA und wirkt auf dieses ein, um ein Uracil zu bilden, das zum Glutamin 2153 (CAA ) Codon in ein Terminationscodon (UAA) umgewandelt wird (2). Apobec-1 wird nur in Darmepithelzellen des erwachsenen Menschen produziert. Es ist der Editierprozess, der die zu synthetisierende apoB-Isoform bestimmt, die wiederum die Art des zu assemblierenden Lipoproteins, entweder Chylomikron oder VLDL-Partikel, bestimmt.


Abbildung 1

Abbildung 1. Schematische Darstellungen der Site-Scanning-Sättigungsmutagenese (SSSM), der Multi-Site-Directed-Mutagenese (MSDM) und der Gensynthese durch PCR-basierte genaue Synthese (PAS)-Workflows. (A, von links nach rechts) SSSM-Workflow: Benutzereingabe umfasst Plasmidsequenz (blau) mit interessierendem Gen, eine Liste der zu ändernden Aminosäurepositionen (rote Quadrate, der Einfachheit halber sind nur 3 Stellen markiert), vorwärts und rückwärts flankierende Primer (Ffwd und Frev, violette Pfeile), degeneriertes Codon (als „X“ markiert) und eine Liste der gewünschten Parameter (Tm, GC-Gehalt, flankierende Primer, etc., nicht gezeigt). Mutation Maker gibt Paare von vorwärts und rückwärts überlappenden mutagenen Primern (gelb) für mehrere parallele PCR-Reaktionen in mehreren 96-Well-Platten (grüner Pfeil) aus. Um N- und C-Genfragmente zu erzeugen, werden zunächst PCR-Reaktionen separat und parallel für jede Stelle (obere bzw. untere Reihe) unter Verwendung mutagener (gelb mit roten Quadraten) und flankierender Primerpaare (violett) und einer Genvorlage ( Blau). Die überlappenden N- und C-Fragmente werden dann mit flankierenden Primern (violett) zusammengenäht. über eine zweite PCR-Reaktion (SOEing, Splicing by Overlap Extension), die Genvarianten voller Länge produziert. Diese werden anschließend gepoolt, um eine Genbibliothek zu erstellen, in der jede Variante eine einzelne zufällige Aminosäuresubstitution an einer bestimmten Position trägt. Danach wird die Bibliothek in einen Expressionsvektor kloniert (blaue Kreise). (B, von links nach rechts) MSDM-Workflow: Die Benutzereingabe umfasst das interessierende Gen und eine Liste von Zielresten und Mutationen (rote Quadrate, der Einfachheit halber sind nur 3 Mutationen gezeigt) und eine Liste von Parametern (Tm, GC, Wirtsorganismus, Entartung, etc., nicht gezeigt). Mutation Maker gibt einen Satz unidirektionaler mutagener Primer (gelb mit roten Quadraten) sowie Primer aus, die Elterncodons tragen (hellgelbe Quadrate auf den Primern), die eine oder mehrere Zielstellen abdecken. Die resultierenden Primer können in MSDM-Experimenten mit dem QuikChange Lightning Multi Site Directed Mutagenesis Kit (Agilent) verwendet werden, um eine vielfältige kombinatorische Bibliothek (blaue Kreise) zu erhalten. (C, von links nach rechts) De novo Gensynthese-Workflow unter Verwendung des PCR-basierten Accurate Synthesis (PAS)-Protokolls. Die Eingabe für den Mutationshersteller besteht aus einem interessierenden Gen (blaue Linie) mit einer Liste von Zielresten und Mutationen (rote Quadrate, wie angegeben) sowie einer Liste von Einschränkungen (Tm, GC, Wirtsorganismus, auszuschließende Motive, Degeneration, etc., nicht gezeigt). Mutation Maker gibt einen Satz überlappender Oligos (gelb) aus, die Mutations- und Elterncodon-Kombinationen (rote bzw. hellgelbe Quadrate) in ihren nicht überlappenden Abschnitten tragen können. Diese Oligos können zu Genvarianten voller Länge (blaue Linien) zusammengesetzt werden, die jeweils unterschiedliche Mutationskombinationen tragen, die später in einen Expressionsvektor (blaue Kreise) kloniert werden können.


Schau das Video: Proteinbiosynthese (Januar 2023).