Information

Rosettenbildung: In welcher Reihenfolge entstehen Blätter

Rosettenbildung: In welcher Reihenfolge entstehen Blätter


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Aus dem Bild unten scheint es, dass sich neue Blätter in etwa so bilden (wenn Sie sich die Pflanze als normale 12-Stunden-Uhr vorstellen):

neues Blatt um 12 Uhr, dann um 7 Uhr, dann um 2 Uhr, dann um 9 Uhr und so weiter.

Ich kann mir vorstellen, dass es so einfache Dinge wie "immer 190 Grad hinzufügen" sein könnten. Sind die genauen Regeln dafür irgendwo für verschiedene Anlagen dokumentiert?


Spiralphyllotaxis und der Goldene Winkel

Die Anordnung der Blätter in Ihrem Bild ist nicht so einfach, wie es scheint. Das ist eine spiralförmige Phyllotaxis, die sehr kompliziert sein kann.

Die Pflanze in Ihrem Bild ist eine Hauswurz, eine Pflanze aus der Gattung Sempervivum. In diesen Pflanzen, so Jeremy Burgess (Einführung in die Pflanzenzellentwicklung):

… Blattprimordien sind in einem Winkelbogen, der sich 137° nähert, voneinander getrennt.

137° ist übrigens (fast) der goldene Winkel (φ).

Hier ist ein Bild, das die Phyllotaxis von erklärt Sempervivum (aus Burgess, 1989):

Noch interessanter ist das Muster der 137,5° GA-Spirale von Aloe polyphylla:

Manchmal kann dies unsichtbare Spiralmuster erzeugen, ein Phänomen namens parastichy:

Quelle: Burgess, J. (1989). Eine Einführung in die Pflanzenzellentwicklung. 1. Aufl. Cambridge [usw.]: Cambridge University Press.

PS: Ich weiß, dass das so ist nicht zum Thema, aber ich möchte dieses Video von Cristóbal Vila teilen, das sich mit der Fibonnaci-Sequenz, dem Goldenen Schnitt und dem Goldenen Winkel in der Natur befasst. Schauen Sie sich die Blumendisposition bei 1:44 an: https://www.youtube.com/watch?v=kkGeOWYOFoA


eine dicht beieinander stehende Blattgruppe an einem kurzen senkrechten Trieb, der sich nur wenig über den Boden erhebt. Die einzelnen Blätter einer Rosette strahlen in alle Richtungen. Die oberen Blätter sind normalerweise kleiner als die unteren und haben kürzere Stiele, die die unteren Blätter etwas beschatten. Rosettenbildende Pflanzen wachsen vor allem an heißen, trockenen Orten und in Polargebieten (meist auf Felsen). Einer der Faktoren, die die Entwicklung von Rosetten beeinflussen, ist die Verdunstung. Beispielsweise entwickeln einige Pflanzen, die normalerweise Rosetten produzieren würden, wenn sie unter Bedingungen erhöhter Luftfeuchtigkeit kultiviert werden, stattdessen Triebe mit langen Internodien und spiralförmig angeordneten Blättern. Viele Pflanzen verschiedener Familien, einschließlich Crassulaceae, Cruciferae, Compositae und Plantaginaceae, haben Rosetten.

eine häufige Krankheit von Obstkulturen (Äpfel, Birnen, Kirschen, Quitten, Pflaumen) und einigen Bäumen und Sträuchern (Ahorn, Weißdorn). Rosette manifestiert sich durch das Auftreten kleiner schmaler Blätter, die zehn bis 30 Mal kleiner sind als normale Blätter, und durch die Entwicklung von Rosetten von zehn bis 20 normalen Blättern an der Spitze des Triebs. Die Krankheit tritt in vielen Ländern auf, einschließlich der UdSSR (hauptsächlich in der Wolga-Region).

Einige Botaniker glauben, dass die Rosette durch Viren verursacht wird, andere halten sie für einen funktionellen pathologischen Prozess, der durch eine Störung der Mineralstoffversorgung, hauptsächlich einen Zinkmangel, verursacht wird. Apfelbäume in Obstplantagen sind am stärksten geschädigt. Rosette kann einzelne Zweige, einen Teil der Krone oder die gesamte Krone betreffen. Die Symptome sind nach der Blüte, dh während des Triebwachstums, ausgeprägt. Rosette senkt die Erregbarkeit der Knospen und die Regenerationsfähigkeit der Triebe, wodurch das Wachstum verkümmert und nackte, schlanke Peitschen in der Krone erscheinen. Stark geschädigte Pflanzen tragen keine Früchte. Eine lange Haltbarkeit der Rosette führt zur Austrocknung der Äste und zum Absterben des Baumes. Die Apfelsorten, die am widerstandsfähigsten gegen die Krankheit sind, sind Common Antonovka, Borovinka, Mal&rsquoty und andere.

Zu den Maßnahmen zur Rosettenbekämpfung gehören das rechtzeitige Ausmerzen erkrankter Pflanzen in der Baumschule, die Herstellung von hochwertigem Impfmaterial, das Besprühen der ruhenden Knospen betroffener Bäume mit Zinksulfat im zeitigen Frühjahr oder unmittelbar nach der Blüte und das Bewässern von Gärten und das Anpflanzen von Luzerne oder anderen Hülsenfrüchten zwischen den Reihen um den Boden anzusäuern und die Zinkassimilation zu verbessern.


Definition des embryonalen Stadiums

Nachdem sich gegen Ende der ersten Woche nach der Befruchtung eine Blastozyste in die Gebärmutter einnistet, wird ihre innere Zellmasse, die als Embryoblast bezeichnet wurde, heute als Embryo bezeichnet. Das Embryonalstadium dauert bis zur achten Woche nach der Befruchtung, danach wird der Embryo Fötus genannt. Das Embryonalstadium ist kurz und dauert insgesamt nur etwa sieben Wochen, aber Entwicklungen, die während dieses Stadiums stattfinden, führen zu enormen Veränderungen im Embryo. Im Embryonalstadium wird der Embryo nicht nur größer, sondern auch viel komplexer. Abbildung (PageIndex<2>) zeigt einen acht bis neun Wochen alten Embryo. Finger, Zehen, Kopf, Augen und andere Strukturen des Embryos sind sichtbar. Es ist keine Übertreibung zu sagen, dass das Embryonalstadium die notwendige Grundlage für alle weiteren Lebensstadien legt.

Abbildung (PageIndex<2>): Ein acht bis neun Wochen alter Embryo


Mehrzellige Rosettenbildung während des Zelleintritts in den aviären Primitivstreifen

Zellbewegungen sind ein grundlegendes Merkmal bei der Entwicklung mehrzelliger Organismen. Bei der Amniongastrulation dringen Zellen durch den Primitivstreifen ein, der die anterior-posteriore Achse des Embryos identifiziert. Wir untersuchten die Zytoskelettarchitektur während dieser morphogenetischen Prozesse und charakterisierten die Mikrotubuli-Organisation in ganzen Hühnerembryonen. Dies zeigte die Verteilung von Zellen mit polarisierten und radialen Mikrotubuli (MT)-Arrays über verschiedene Regionen des Embryos. Zellen im Epiblast zeigten normalerweise radiale MT-Arrays, während die Mehrheit der Zellen im Primitivstreifen polarisierte MT-Arrays aufwies. Innerhalb des Primitivstreifens organisierten sich viele Zellen in Gruppen und waren in rosettenartigen Strukturen mit einem ausgeprägten Zentrum angeordnet, das durch eine Ansammlung von Aktin gekennzeichnet war. Erweiterte konfokale Mikroskopie und dreidimensionale Bildrekonstruktion identifizierten Spitzen von polarisierten Zellen, die aus der Rosettenebene herausragten, normalerweise aus der Mitte. Wir schlagen vor, dass die Organisation in Strukturen höherer Ordnung das Eindringen von Zellen während der Gastrulation erleichtert. Entwicklungsdynamik 237:91–96, 2008. © 2007 Wiley-Liss, Inc.

Das ergänzende Material, auf das in diesem Artikel Bezug genommen wird, kann unter www.interscience.wiley.com/jpages/1058-8388/suppmat eingesehen werden

Dateiname Beschreibung
dvdy21390-DVDY21390Supplemental_movie1.mov4.8 MB Ergänzungsfilm 1: Eine 3D-Rekonstruktion in Volocity wurde als Quicktime-Film exportiert. Abbildung 2C-F zeigt Standbilder dieser Sequenz. Siehe Legende für Details.

Bitte beachten Sie: Der Herausgeber ist nicht verantwortlich für den Inhalt oder die Funktionalität der von den Autoren bereitgestellten unterstützenden Informationen. Alle Anfragen (außer fehlenden Inhalten) sollten an den entsprechenden Autor des Artikels gerichtet werden.


Rosetten zur Verlängerung

Rosetten (oben) bilden sich durch vertikale Kontraktion und entspannen sich dann horizontal (unten, von links nach rechts).

Die Rosetten sind auffällig, aber es hat lange gedauert, bis sie identifiziert wurden. „Ich habe auch viel Zeit damit verbracht, sie nicht zu sehen“, sagt Zallen. „Es hat den Unterschied gemacht, Filme zu machen – dann sieht man, dass sie richtungsweisend sind. Wenn ich jetzt Zeitungen lese, sehe ich sie die ganze Zeit.“

In einem früheren Modell für die Dehnung, dem sogenannten Neighbor Exchange, wurde vorgeschlagen, dass sich vertikal verlaufende Einzelzellübergänge zu einem Punkt zusammenziehen und dann horizontal wieder ausdehnen. „Diese Verhaltensweisen passieren, aber wir denken, dass sie nur ein Teil der Geschichte sind“, sagt Zallen. "Die erforderliche Startreihenfolge ist nicht da."

Aber wie definiert man „Ordnung“? „Ich hatte zunächst kein Vokabular, um es zu beschreiben“, sagt Zallen. Aber zusammen mit ihrem Physiker-Vater benutzte sie Quantifizierungsmethoden, die denen bekannt sind, die Seifenblasen studieren. Paradoxerweise fanden sie heraus, dass die Störung auf zellulärer Ebene zunahm, selbst wenn sich das Gewebe seinem gestreckten, globaler geordneten Zustand näherte.

Die erhöhte Unordnung scheint auf die Rosettenbildung zurückzuführen zu sein. Musterbildungsgene treiben die Akkumulation von Aktin und dann Myosin an den anterioposterioren Zellgrenzen an, und das Ziehen von Aktomyosin parallel zur Membran hilft wahrscheinlich bei der Bildung der Rosetten.

Bei einer 25-minütigen Verfolgung der sogenannten Keimbandverlängerung werden 87% der Zellen vorübergehend in eine oder mehrere Rosetten eingebaut. Dieses Ausmaß der Neuordnung kann zusammen mit dem Nachbaraustausch den größten Teil der beobachteten Dehnung erklären. Der Mechanismus für die Rosettenauflösung ist unklar, Hinweise sollten von der Isolierung von Komponenten stammen, die stromabwärts von Mustergenen liegen.


Materialen und Methoden

Fischpflege und Bestände

Zebrafische wurden unter Standardbedingungen gehalten (Westerfield, 1994). Embryonen wurden mittels HPF bei 28,5°C (Kimmel et al., 1995) und entsprechend der Somitenzahl inszeniert. Die morphologische und immunhistologische Analyse von lgl2 Morphants wurde im AB-Hintergrund durchgeführt.

DNA-Konstrukte und ortsgerichtete Mutagenese

Die kodierende Region des Zebrafisches lgl2 wurde PCR-amplifiziert und in die ClaIch und XhoI Restriktionsschnittstellen des Expressionsvektors pCS2+. In ähnlicher Weise ist die kodierende Region voller Länge von lg1 wurde aus cDNA mittels PCR amplifiziert und in pCS2+ subkloniert. Der N-terminale myc-Tag wurde durch Subklonieren der Konstrukte in pCS2+myc erzeugt. Weitere Details sind auf Anfrage erhältlich. IMAGp998C239110Q3 mit voller Länge lgl2 wurde vom RZPD gekauft. Die ortsgerichtete Mutagenese wurde unter Verwendung des Quick Change Site Directed Mutagenesis Kit (Stratagene, CA, USA) durchgeführt. Der PCS2+14xUAS E1b lgl2:eGFP (Koester und Fraser, 2001) wurde durch die Einführung des Claich (stumpfes Ende)/XhoIch Fragment von lgl2 in den Expressionsvektor pCS2+ 14xUAS. Die folgenden Mutagenese-Primersequenzen wurden für lgl2 S5A : 5′-CACGAGTCAAGGCCATCAAAAAGAGBCTGCGACAGGCCTTCCGCAG-3′ und 5′-GATTCGCCGC AGBCGAGTCGCCATGCGCAAAC-3′. Fettgedruckte Nukleotide zeigen Veränderungen gegenüber der Wildtyp-Sequenz an.

RNA- und Morpholino-Injektionen

DNA-Konstrukte wurden unter Verwendung des SP6 MessageMachine-Kits (Ambion) transkribiert. In vitro synthetisierte mRNA mit Kappe wurde in Wasser gelöst und vor der Injektion mit dem MO gemischt. Typischerweise wurden 100 pg RNA zur Rettung und Überexpression in AB-Embryonen injiziert. MOs (Gene Tools) wurden in Konzentrationen von 70 und 100 µmol/l injiziert.

MO-Sequenzen waren: MO lgl2-Utra , 5′-TCCCTGGACGAGCCGGGACTCAAAC-3′ MO lgl2-utrb , 5′-AGCCGGGACTCAAACTGCCCTCTCT-3′ MO lgl2-atg , 5′-GCCCATGACGCCTGAACCTCTTCAT-3′ MO lgl1-atg , 5′-CCGTCTGAACCTAAACTTCATCATC-3′MO lgl1-utr , 5′-TGAAGCCGAATCAGAGGTAAATCAC-3′ MO prkci : 5′-TGTCCCGCAGCGTGGGCATTATGGA-3′ MO prkcz , 5′-GATCCGTTACTGACAGGCATTATA-3′ und MO p53 , 5'-GCGCCATTGCTTTGCAAGAATTG-3'.

In-situ-Hybridisierung

Whole-mount-in-situ-Hybridisierung wurde wie zuvor beschrieben durchgeführt (Jowett und Lettice, 1994). Digoxigenin-UTP-markierte Ribosonden wurden gemäß den Anweisungen des Herstellers (Boehringer Mannheim) synthetisiert. Die Sonde für lgl2 wurde aus cDNA amplifiziert und in den TOPO-Vektor subkloniert. Die verwendeten Primer waren: 5'-CGGCTCGAGCTTGCTCACCTTCAC-3' und 5'-CCCATAACTGGCCCTCGGCATCCC-3'.

Die Sonde für eya1 war ein Geschenk von C. Petit. Die Sonde für getroffen wurde aus cDNA amplifiziert und in den TOPO-Vektor subkloniert. Folgende Primer wurden verwendet: 5′-CACTATTCTGAAGCTGCTTCCATCC-3′ und 5′-CGTGATGGAGATAAGGCAAACGGC-3′

Zur Dokumentation wurden Embryonen dehydriert, in Benzyl:Benzoat geklärt und in Permount (Fisher Scientific) montiert. Die Bilder wurden mit einem Zeiss Axioplan 2 Mikroskop mit 10× und 20× Objektiven und der Metamorph Imaging Software Version 6.1 (Visitron) aufgenommen. Die Bilder wurden mit Adobe Photoshop-Software (Adobe Systems) verarbeitet.

Die Quantifizierung von ZO1-positiven Bereichen wurde auf Regionen von Interesse (ROIs) von konfokalen Bildern durchgeführt z-Stapelprojektionen mit der Partikelanalysefunktion ImageJ (http://rsb.info.nih.gov/ij/index.html) (Parameter auf Anfrage erhältlich). Die statistische Analyse wurde unter Verwendung einer Einweg-ANOVA durchgeführt. EIN P Ein Wert von weniger als 0,05 wurde als Signifikanz angesehen. Die Neuromastverteilungsanalyse wurde an 48 hpf-Embryonen durchgeführt. Die statistische Analyse wurde je nach Bedarf unter Verwendung einer Zweiwege-ANOVA oder des F-Tests durchgeführt. EIN P-Wert von weniger als 0,05 wurde als Signifikanz angesehen.

Alle statistischen Analysen wurden unter Verwendung der Statistiksoftware GraphPad Prism 4 (GraphPad Software, La Jolla, CA, USA) durchgeführt.

Immunhistochemie, Western Blotting und Phalloidin-Färbung

Immunhistochemie und Phalloidinfärbung wurden wie zuvor beschrieben durchgeführt (Horne-Badovinac et al., 2001). Die immunhistochemische Delta D- und β-Catenin-Färbung wurde durch Fixieren von Embryonen in 10 % TCA, gefolgt von mehreren Spülungen und Permeabilisierung mit 0,2 % Triton X-100 für 30 Minuten, gefolgt von Blockieren für 2 Stunden durchgeführt. Vor dem Anbringen wurde gefärbtes Gewebe durch eine Reihe von abgestuftem Glycerin von 25 %, 50 % und 75 % übertragen. Für Western-Blotting verwendeten wir im Wesentlichen das gleiche Protokoll wie zuvor beschrieben (Horne-Badovinac et al., 2001) unter Verwendung von embryonalen Geweben, die auf 24–30 hpf inszeniert wurden.

Folgende Antikörper wurden verwendet: Kaninchen anti-aPKCζ (1:200, Santa Cruz Biotechnology, USA) Maus anti-ZO1 (1:200, Zymed) Maus anti-human E-Cadherin (1:200, BD Biosciences Pharmingen, Material Number 610182) Maus-Anti-γ-Tubulin (1:200, Biozol) Maus-Anti-Delta D (1:400) (Itoh et al., 2003) Kaninchen-Anti-β-Catenin (1:600, ein Geschenk des Birchmeier-Labors ) Kaninchen Anti-Xenopus Lgl1 C-Terminus (ein Geschenk des Sokol-Labors) (Dollar et al., 2005) und Ziegen-Anti-Maus-RRX (1:200), Anti-Kaninchen-Cy5 (1:200), Anti-Maus-Cy5 (1:200) und Anti-Kaninchen-Cy2 (1:200) (Jackson ImmunoResearch). Die Kernfärbung wurde unter Verwendung von 4′6-Diamidino-2-phenylindol, Dihydrochlorid (1:1000, FluoroPure-Qualität) durchgeführt. Konfokale Bilder wurden mit dem konfokalen Mikroskop Zeiss LSM510 META unter Verwendung eines Plan Neofluar 100× Ölimmersionsobjektivs und Zoom 1.0 aufgenommen. Konfokale Bilder und dreidimensionale Rekonstruktionen von z-Stacks wurden mit der LSM 510 Meta Software durchgeführt. Die Bilder wurden mit Photoshop-Software (Adobe) bearbeitet.

Zeitrafferaufnahmen

Vor der Live-Bildgebung wurden Embryonen mit 100 &mgr;M des Vitalfarbstoffs BODIPY-Ceramid (Molecular Probes) 1 Stunde in Danieau's inkubiert. Embryonen wurden in 1,8% niedrig schmelzender Agarose montiert und mit Tricain (Sigma) anästhesiert und unter Verwendung des konfokalen Mikroskops Zeiss LSM510 META unter Verwendung einer Plan Neofluar 40× Ölimmersionslinse und Zoom 1.0 abgebildet.


Arten von Blattformen

Blätter können als einfach oder zusammengesetzt kategorisiert werden, je nachdem, wie ihre Klinge (oder Lamina) geteilt ist.

Lernziele

Unterscheiden Sie zwischen den Arten von Blattformen

Die zentralen Thesen

Wichtige Punkte

  • Bei einem einfachen Blatt ist die Blattspreite völlig ungeteilt Blätter können auch aus Lappen gebildet sein, bei denen die Lücken zwischen den Lappen nicht bis zur Hauptader reichen.
  • Bei einem zusammengesetzten Blatt ist die Blattspreite geteilt und bildet Blättchen, die an der Mittelader befestigt sind, aber ihre eigenen Stiele haben.
  • Die Blättchen der handförmig zusammengesetzten Blätter strahlen vom Ende des Blattstiels nach außen.
  • Gefiederte Blätter haben ihre Blättchen entlang der Mittelader angeordnet.
  • Zweifach zusammengesetzte (doppelt zusammengesetzte) Blätter haben ihre Blättchen entlang einer sekundären Ader, die eine von mehreren Adern ist, die von der mittleren Ader abzweigen.

Schlüsselbegriffe

  • einfaches Blatt: ein Blatt mit einer ungeteilten Klinge
  • zusammengesetztes Blatt: ein Blatt, bei dem die Blattspreite geteilt ist und Blättchen bildet
  • handförmig zusammengesetztes Blatt: Blatt, dessen Blättchen vom Ende des Blattstiels nach außen strahlen
  • gefiedertes zusammengesetztes Blatt: ein Blatt, bei dem die Blättchen entlang der Mittelader angeordnet sind

Blattform

Es gibt zwei Grundformen von Blättern, die unter Berücksichtigung der Teilung der Blattspreite (oder Lamina) beschrieben werden können. Blätter können einfach oder zusammengesetzt sein.

Einfache und zusammengesetzte Blätter: Blätter können einfach oder zusammengesetzt sein. Bei einfachen Blättern ist die Lamina durchgehend. (a) Die Bananenpflanze (Musa sp.) hat einfache Blätter. Bei zusammengesetzten Blättern ist die Lamina in Blättchen unterteilt. Zusammengesetzte Blätter können handförmig oder gefiedert sein. (b) In handförmig zusammengesetzten Blättern, wie denen der Rosskastanie (Aesculus hippocastanum), verzweigen sich die Blättchen vom Blattstiel. (c) Bei gefiederten Blättern verzweigen sich die Blättchen von der Mittelrippe, wie bei einem Strauchhickory (Carya Floridaana). (d) Die Honigheuschrecke hat doppelt zusammengesetzte Blätter, in denen sich Blättchen aus den Adern verzweigen.

Bei einem einfachen Blatt, wie dem Bananenblatt, ist die Blattspreite komplett ungeteilt. Die Blattform kann auch aus Lappen gebildet sein, bei denen die Lücken zwischen den Lappen nicht bis zur Hauptader reichen. Ein Beispiel für diese Art ist das Ahornblatt.

Bei einem zusammengesetzten Blatt ist die Blattspreite vollständig geteilt und bildet Blättchen wie bei der Heuschrecke. Zusammengesetzte Blätter sind ein Merkmal einiger Familien höherer Pflanzen. Jedes Blättchen ist an der Rachis (Mittelvene) befestigt, kann aber einen eigenen Stiel haben. Ein handförmig zusammengesetztes Blatt hat seine Blättchen vom Ende des Blattstiels nach außen, wie Finger von einer Handfläche. Beispiele für Pflanzen mit handförmig zusammengesetzten Blättern sind Giftefeu, die Rosskastanie oder die bekannte Zimmerpflanze Schefflera sp. (allgemein als “Regenschirmpflanze” bezeichnet). Gefiedert zusammengesetzte Blätter haben ihren Namen von ihrem federartigen Aussehen, die Blättchen sind entlang der Mittelader angeordnet, wie bei Rosenblättern oder den Blättern von Hickory-, Pekannuss-, Eschen- oder Walnussbäumen. Bei einem gefiederten Blatt wird die Mittelader als Mittelrippe bezeichnet. Zweifach gefiederte (oder doppelt zusammengesetzte) Blätter sind doppelt geteilt, die Blättchen sind entlang einer Nebenader angeordnet, die eine von mehreren Adern ist, die von der Mittelader abzweigen. Jede Broschüre wird als “pinnule” bezeichnet. Die Pinnüls an einer Nebenvene werden “pinna” genannt. Der Seidenbaum (Albizia) ist ein Beispiel für eine Pflanze mit zweifach gefiederten Blättern.


MATERIALEN UND METHODEN

Pflanzenwachstum, transgene Pflanzen und Phänotypen

T-DNA-Insertionslinien für LMI1 wurden aus der SALK-Sammlung (Alonso et al., 2003) erhalten und zweimal in den Wildtyp rückgekreuzt (Col). LFY-Allele wurden von der Samensammlung des Arabidopsis Biological Resource Center (ABRC) erhalten (http://www.biosci.ohio-state.edu/

plantbio/Facilities/abrc/abrchome.htm). Die Pflanzen wurden bei 22 °C unter Langtag- (16 Stunden Licht) oder Kurztag-(9 Stunden Licht)-Bedingungen bei 120 &mgr;mol/m 2 s kaltweißem Licht gezüchtet. Die Anzahl der Rosettenblätter wurde beim Schossen gezählt, und die Anzahl der sekundären Blütenstände und der Deckblätter wurde nach der Bildung der ersten Blüten gezählt. Sitzende Blätter ohne Blattstiele, die sekundäre Blütenstände bedecken, oder Blüten auf dem primären Blütenstand werden in diesem Text in Übereinstimmung mit der von Dinneny et al. vorgeschlagenen Verwendung als Hochblätter bezeichnet (Dinneny et al., 2004). Seitliche Anhängsel wurden als sekundäre Blütenstände betrachtet, wenn der Zweig mindestens 3 cm lang war und mindestens drei Blüten trug.

35S:MYC-LMI1-HA wurde in 35S:LFY-GR-Pflanzen (Wagner et al., 1999) unter Verwendung des Pflanzentransformationsvektors pGAL3300 erzeugt. Ein 9 × MYC-Epitop-Tag (Feldman et al., 1997) wurde im Raster am N-terminalen Ende und ein 3 × HA-Epitop-Tag am C-terminalen Ende hinzugefügt. Die volle Länge LMI1 cDNA wurde durch PCR aus Sämling-RNA nach reverser Transkription amplifiziert, gefolgt von Sequenzierung. Die zur Amplifikation verwendeten Primer waren GAGTGGTCAACAACGAGCAA und GGAAATCGGTACGCATTCAT. Es wurden mehrere unabhängige transgene Linien isoliert, die das LMI1-Protein in voller Länge exprimierten und eine erhöhte LMI1 Expression im Vergleich zum Wildtyp. Linie 23 wurde für Chromatin-Immunpräzipitationen verwendet, ähnliche Ergebnisse wie die hier vorgestellten wurden mit anderen Linien erhalten.

Für Reporteranalysen verwendeten wir pBI101 (Clontech, Mountain View, CA) plus 3955 bp stromaufwärts des LMI1-Translationsstarts. Außerdem wurden 1016 bp der stromabwärts gelegenen intergenischen Region verwendet, um die NOS-Terminatorsequenz in pBI101 zu ersetzen. Die Pflanzentransformation wurde wie zuvor beschrieben durchgeführt (Bechthold und Ellis, 1993). Die Pflanzen wurden unter Verwendung eines Olympus SZX12 Seziermikroskops, ausgestattet mit einer SPOT Insight Kamera (Diagnostic, Sterling Heights, MI), fotografiert.

RT-PCR und Echtzeit-PCR

Gesamt-RNA wurde aus oberirdischen Pflanzengeweben isoliert, die in kontinuierlichem Licht bei 55 &mgr;mol/m 2 s auf Murashige- und Skoog-Medium halber Stärke gezüchtet wurden. RNA-Isolierung und RT-PCR wurden wie beschrieben durchgeführt (William et al., 2004). Eine quantitative Echtzeit-PCR wurde an RNA, die mit DNase Set (Qiagen, Valencia, CA) behandelt wurde, in einer 20-μl-PCR-Reaktion unter Verwendung des QuantiTect SYBR Green PCR Kit (Qiagen, Valencia, CA) auf einem DNA Engine Opticon Thermal Cycler (MJ .) durchgeführt Forschung). Die Temperaturwechselbedingungen waren wie folgt: 15 Minuten bei 95 °C, 44 Zyklen von 15 Sekunden bei 94 °C, 30 Sekunden bei 54 °C und 30 Sekunden bei 72 °C, gefolgt von einer Schmelzkurvenanalyse. Die relativen Mengen aller mRNA wurden aus Schwellenzykluswerten und Standardkurven berechnet und mit dem Niveau des eukaryotischen Translationsinitiationsfaktors 4A-1 (EIF4A) für mRNA und Eingabe für ChIP. Einzelheiten zu Primern (und Amplifikationszyklusnummern) finden Sie in Tabelle S1 im ergänzenden Material.

Chromatin-Immunpräzipitation

Die Chromatin-Immunpräzipitation wurde im Wesentlichen wie zuvor beschrieben durchgeführt (Kwon et al., 2005 William et al., 2004), außer dass 100 mg Gewebe pro Probe verwendet wurden. Das verwendete MYC-Antiserum stammte von der Myc1-9E10-Zelllinie. Nach Bindung der Immunkomplexe an magnetische Protein-G-Beads (Dynal, Brown Deer, WI) wurden Waschungen gemäß Ricci et al. (Ricci et al., 2002). Einzelheiten zu den für ChIP verwendeten Primern finden Sie in Tabelle S1 im Zusatzmaterial.

GUS-Assays und Schnitte

GUS-Färbung und histologische Schnitte wurden wie zuvor beschrieben durchgeführt (Sieburth und Meyerowitz, 1997), außer dass das Gewebe mit FAA 1 Stunde bei Raumtemperatur fixiert wurde. Die Färbung erfolgte vier Stunden lang bei 37 °C oder 20 Stunden lang bei 30 °C. Die Gewebereinigung erfolgte wie von Kwon et al. (Kwon et al., 2005) beschrieben.


Inhalt

Arabidopsis thaliana ist eine einjährige (selten zweijährige) Pflanze, die normalerweise 20–25 cm hoch wird. [6] Die Blätter bilden eine Rosette an der Basis der Pflanze, mit einigen Blättern auch am Blütenstiel. Die Grundblätter sind grün bis leicht violett gefärbt, 1,5–5 cm lang und 2–10 mm breit, mit einem ganzen bis grob gesägten Rand die Stängelblätter sind kleiner und ungestielt, meist ganzrandig. Die Blätter sind mit kleinen, einzelligen Haaren bedeckt, die als Trichome bezeichnet werden. Die Blüten haben einen Durchmesser von 3 mm, sind in einer Dolde angeordnet, ihre Struktur entspricht der der typischen Brassicaceae. Die Frucht ist eine 5–20 mm lange Siliqua, die 20–30 Samen enthält. [9] [10] [11] [12] Wurzeln sind einfach in der Struktur, mit einer einzigen Primärwurzel, die vertikal nach unten wächst und später kleinere Seitenwurzeln hervorbringt. Diese Wurzeln bilden Wechselwirkungen mit Rhizosphärenbakterien wie Bacillus megaterium. [13]

A. thaliana kann seinen gesamten Lebenszyklus in sechs Wochen abschließen. Der zentrale Stängel, der Blüten produziert, wächst nach etwa 3 Wochen und die Blüten bestäuben sich auf natürliche Weise selbst. Im Labor, A. thaliana kann in Petrischalen, Töpfen oder Hydrokulturen, unter Leuchtstofflampen oder in einem Gewächshaus angebaut werden. [14]

Die Pflanze wurde erstmals 1577 im Harz von Johannes Thal (1542–1583), einem Arzt aus Nordhausen, Thüringen, beschrieben Pilosella siliquosa. 1753 benannte Carl von Linné das Werk um Arabis thaliana zu Ehren von Thal. 1842 errichtete der deutsche Botaniker Gustav Heynhold die neue Gattung Arabidopsis und ordnete die Pflanze dieser Gattung zu. Der generische Name, Arabidopsis, kommt aus dem Griechischen und bedeutet "ähnlich" Arabis“ (die Gattung, in die Linnaeus es ursprünglich eingeordnet hatte).

Tausende von natürlichen Inzucht-Zugängen von A. thaliana wurden aus dem gesamten natürlichen und eingeführten Verbreitungsgebiet gesammelt. [15] Diese Akzessionen weisen beträchtliche genetische und phänotypische Variationen auf, die verwendet werden können, um die Anpassung dieser Art an unterschiedliche Umgebungen zu untersuchen. [fünfzehn]

A. thaliana stammt aus Europa, Asien und Afrika, und seine geographische Verbreitung ist vom Mittelmeer bis Skandinavien und von Spanien bis Griechenland ziemlich kontinuierlich. [16] Es scheint auch in tropischen alpinen Ökosystemen in Afrika und vielleicht in Südafrika heimisch zu sein. [17] [18] Es wurde weltweit eingeführt und eingebürgert, [19] auch in Nordamerika um das 17. Jahrhundert. [20]

A. thaliana wächst leicht und ist oft Pionier auf steinigen, sandigen und kalkhaltigen Böden. Aufgrund seiner weit verbreiteten Verbreitung auf landwirtschaftlichen Feldern, Straßenrändern, Eisenbahnlinien, Brachflächen und anderen gestörten Lebensräumen wird es im Allgemeinen als Unkraut angesehen [19] [21] aber aufgrund seiner begrenzten Wettbewerbsfähigkeit und geringen Größe wird es nicht kategorisiert als schädliches Unkraut. [22] Wie die meisten Brassicaceae-Arten A. thaliana ist für den Menschen in Salaten essbar oder gekocht, erfreut sich aber als Frühlingsgemüse nicht einer weiten Verbreitung. [23]

Botaniker und Biologen begannen zu forschen A. thaliana in den frühen 1900er Jahren, und die erste systematische Beschreibung von Mutanten erfolgte um 1945. [24] A. thaliana wird heute häufig für das Studium der Pflanzenwissenschaften verwendet, einschließlich Genetik, Evolution, Populationsgenetik und Pflanzenentwicklung. [25] [26] [27] Obwohl A. thaliana wenig direkte Bedeutung für die Landwirtschaft hat, machen ihn mehrere seiner Merkmale zu einem nützlichen Modell für das Verständnis der genetischen, zellulären und molekularen Biologie von Blütenpflanzen.

Die erste Mutante in A. thaliana wurde 1873 von Alexander Braun dokumentiert und beschrieb einen Doppelblüten-Phänotyp (das mutierte Gen war wahrscheinlich Agamous, geklont und charakterisiert im Jahr 1990). [28] Friedrich Laibach (der die Chromosomenzahl 1907) veröffentlicht hatte, schlug dies nicht vor A. thaliana als Modellorganismus jedoch bis 1943. [29] Seine Studentin Erna Reinholz veröffentlichte ihre Dissertation über A. thaliana 1945, die erste Sammlung von A. thaliana Mutanten, die sie durch Röntgen-Mutagenese erzeugt haben. Laibach setzte seine wichtigen Beiträge zu A. thaliana Forschung durch das Sammeln einer großen Zahl von Akzessionen (oft fraglich als "Ökotypen" bezeichnet). Diese wurden mit Hilfe von Albert Kranz zu einer großen Sammlung von 750 natürlichen Akzessionen von A. thaliana aus aller Welt.

In den 1950er und 1960er Jahren spielten John Langridge und George Rédei eine wichtige Rolle bei der Gründung A. thaliana als nützlicher Organismus für biologische Laborexperimente. Rédei verfasste mehrere wissenschaftliche Rezensionen, die maßgeblich zur Einführung des Modells in die wissenschaftliche Gemeinschaft beigetragen haben. Der Beginn der A. thaliana Forschungsgemeinschaft verabredet sich zu einem Newsletter namens Arabidopsis Informationsdienst, [30] gegründet 1964. Der erste internationale Arabidopsis Die Konferenz fand 1965 in Göttingen, Deutschland, statt.

In den 1980er Jahren, A. thaliana begann, in Pflanzenforschungslabors auf der ganzen Welt weit verbreitet zu sein. Es war einer von mehreren Kandidaten, die Mais, Petunie und Tabak enthielten. [29] Die beiden letztgenannten waren attraktiv, da sie mit den damals aktuellen Technologien leicht transformierbar waren, während Mais ein gut etabliertes genetisches Modell für die Pflanzenbiologie war. Das Durchbruchsjahr für A. thaliana als Modellpflanze diente 1986, in der T-DNA-vermittelte Transformation und die erste klonierte A. thaliana Gen beschrieben. [31] [32]

Genomik Bearbeiten

Kerngenom Bearbeiten

Aufgrund der geringen Größe seines Genoms und weil es diploid ist, Arabidopsis thaliana ist nützlich für die genetische Kartierung und Sequenzierung – mit etwa 157 Megabasenpaaren [35] und fünf Chromosomen, A. thaliana hat eines der kleinsten Genome unter den Pflanzen. [8] Es wurde lange angenommen, dass es das kleinste Genom aller Blütenpflanzen hat, [36] aber dieser Titel wird heute als zu den Pflanzen der Gattung gehörend angesehen Genlisea, Lamiales bestellen, mit Genlisea tuberosa, eine fleischfressende Pflanze mit einer Genomgröße von ungefähr 61 Mbp. [37] Es war das erste sequenzierte Pflanzengenom, das im Jahr 2000 von der Arabidopsis Genome Initiative fertiggestellt wurde. [38] Die aktuellste Version des A. thaliana Genom wird von der Arabidopsis Information Resource gepflegt. [39]

27.600 Protein-kodierende Gene und etwa 6.500 nicht-kodierende Gene. [40] Die Uniprot-Datenbank listet jedoch 39.342 Proteine ​​in ihrer Arabidopsis Referenzproteom. [41] Von den 27.600 proteinkodierenden Genen sind mittlerweile 25.402 (91,8%) mit „sinnvollen“ Produktnamen annotiert, [42] obwohl ein Großteil dieser Proteine ​​wahrscheinlich nur wenig verstanden und nur allgemein bekannt ist (z. B. als „ DNA-bindendes Protein ohne bekannte Spezifität) Uniprot listet als Teil des Referenzproteoms mehr als 3.000 Proteine ​​als „uncharakterisiert“ auf.

Chloroplasten-Genom Bearbeiten

Das Plastom von A. thaliana ist ein 154.478 Basenpaare langes DNA-Molekül, [33] eine Größe, die typischerweise bei den meisten Blütenpflanzen anzutreffen ist (siehe die Liste der sequenzierten Plastome). Es umfasst 136 Gene, die für kleine ribosomale Proteine ​​der Untereinheit (rps, in gelb: siehe Abbildung), große Untereinheit ribosomaler Proteine ​​(rpl, orange), hypothetische Chloroplasten-Proteine ​​mit offenem Leserahmen (ycf, Zitrone), Proteine, die an photosynthetischen Reaktionen (grün) oder an anderen Funktionen beteiligt sind (rot), ribosomale RNAs (rrn, blau) und Transfer-RNAs (trn, Schwarz). [34]

Mitochondriales Genom Bearbeiten

Das mitochondriale Genom von A. thaliana ist 367.808 Basenpaare lang und enthält 57 Gene. [43] Es gibt viele sich wiederholende Regionen in der Arabidopsis mitochondriales Genom. Die größten Wiederholungen rekombinieren regelmäßig und isomerisieren das Genom. [44] Wie die meisten mitochondrialen Genome von Pflanzen ist das Arabidopsis Mitochondriales Genom existiert als komplexe Anordnung von überlappenden verzweigten und linearen Molekülen in vivo. [45]

Genetik Bearbeiten

Genetische Transformation von A. thaliana ist Routine, mit Agrobacterium tumefaciens DNA in das Pflanzengenom zu übertragen. Das aktuelle Protokoll, das als "floral dip" bezeichnet wird, beinhaltet das einfache Eintauchen von Blumen in eine Lösung mit Agrobakterium das ein interessierendes Plasmid und ein Detergens trägt. [46] [47] Diese Methode vermeidet die Notwendigkeit einer Gewebekultur oder Pflanzenregeneration.

Die A. thaliana Gen-Knockout-Sammlungen sind eine einzigartige Ressource für die Pflanzenbiologie, die durch die Verfügbarkeit von Hochdurchsatz-Transformationen und die Finanzierung von Genomikressourcen ermöglicht wird. Die Stelle der T-DNA-Insertion wurde für über 300.000 unabhängige transgene Linien bestimmt, wobei die Informationen und Samen über Online-T-DNA-Datenbanken zugänglich sind. [48] ​​Durch diese Sammlungen sind Insertionsmutanten für die meisten Gene in verfügbar A. thaliana.

Charakterisierte Akzessionen und mutierte Linien von A. thaliana dienen als Versuchsmaterial in Laborstudien. Die am häufigsten verwendeten Hintergrundlinien sind Lähm (Landsberg erekta) und Col oder Columbia. [49] Andere in der wissenschaftlichen Literatur weniger häufig zitierte Hintergrundlinien sind Ws oder Wassilewskija, C24, Cvi, oder Kapverdische Inseln, Nossen usw. (siehe z. B. [50]). 0, Col-1 usw. wurden im Allgemeinen erhalten und charakterisiert, mutierte Linien sind über Stock Center erhältlich, von denen die bekanntesten das Nottingham Arabidopsis Stock Center-NASC [49] und das Arabidopsis Biological Resource Center-ABRC sind Ohio, USA. [51] Die Col-0-Akzession wurde von Rédei aus einer (nicht bestrahlten) Population von Samen mit der Bezeichnung 'Landsberg' ausgewählt, die er von Laibach erhielt. [52] Columbia (benannt nach dem Standort von Rédeis ehemaliger Institution, University of Missouri-Columbia) war der Referenzzugang, der in der Arabidopsis Genom-Initiative. Die Spätere (Landsberg erecta)-Linie wurde von Rédei (wegen ihrer Kleinwüchsigkeit) aus einer Landsberg-Population ausgewählt, die er mit Röntgenstrahlen mutagenisiert hatte. Als das Lähm Sammlung von Mutanten wird von dieser Anfangslinie abgeleitet, Lähm-0 entspricht nicht den Landsberg-Akzessionen, die La-0, La-1 usw.

Die Trichombildung wird durch das GLABROUS1-Protein initiiert. Knockouts des entsprechenden Gens führen zu kahlen Pflanzen. Dieser Phänotyp wurde bereits in Gen-Editing-Experimenten verwendet und könnte als visueller Marker für die Pflanzenforschung von Interesse sein, um Gen-Editing-Methoden wie CRISPR/Cas9 zu verbessern. [53] [54]

Nicht-Mendelsche Vererbungskontroverse Bearbeiten

Im Jahr 2005 schlugen Wissenschaftler der Purdue University vor, dass A. thaliana eine Alternative zu bisher bekannten Mechanismen der DNA-Reparatur besaß und ein ungewöhnliches Vererbungsmuster erzeugte, aber das beobachtete Phänomen (Reversion mutierter Kopien des HITZKOPF Gen in einen Wildtyp-Zustand) wurde später als Artefakt vermutet, da die Mutanten aufgrund der Organfusion eine erhöhte Auskreuzung zeigen. [55] [56] [57]

Lifecycle Edit

The plant's small size and rapid lifecycle are also advantageous for research. Having specialized as a spring ephemeral, it has been used to found several laboratory strains that take about 6 weeks from germination to mature seed. The small size of the plant is convenient for cultivation in a small space, and it produces many seeds. Further, the selfing nature of this plant assists genetic experiments. Also, as an individual plant can produce several thousand seeds, each of the above criteria leads to A. thaliana being valued as a genetic model organism.

Flower development Edit

A. thaliana has been extensively studied as a model for flower development. The developing flower has four basic organs - sepals, petals, stamens, and carpels (which go on to form pistils). These organs are arranged in a series of whorls, four sepals on the outer whorl, followed by four petals inside this, six stamens, and a central carpel region. Homeotic mutations in A. thaliana result in the change of one organ to another—in the case of the agamous mutation, for example, stamens become petals and carpels are replaced with a new flower, resulting in a recursively repeated sepal-petal-petal pattern.

Observations of homeotic mutations led to the formulation of the ABC model of flower development by E. Coen and E. Meyerowitz. [58] According to this model, floral organ identity genes are divided into three classes - class A genes (which affect sepals and petals), class B genes (which affect petals and stamens), and class C genes (which affect stamens and carpels). These genes code for transcription factors that combine to cause tissue specification in their respective regions during development. Although developed through study of A. thaliana flowers, this model is generally applicable to other flowering plants.

Leaf development Edit

Studium von A. thaliana have provided considerable insights with regards to the genetics of leaf morphogenesis, particularly in dicotyledon-type plants. [59] [60] Much of the understanding has come from analyzing mutants in leaf development, some of which were identified in the 1960s, but were not analysed with genetic and molecular techniques until the mid-1990s. A. thaliana leaves are well suited to studies of leaf development because they are relatively simple and stable.

Verwenden von A. thaliana, the genetics behind leaf shape development have become more clear and have been broken down into three stages: The initiation of the leaf primordium, the establishment of dorsiventrality, and the development of a marginal meristem. Leaf primordia are initiated by the suppression of the genes and proteins of class I KNOX family (such as SHOOT APICAL MERISTEMLESS). These class I KNOX proteins directly suppress gibberellin biosynthesis in the leaf primordium. Many genetic factors were found to be involved in the suppression of these class I KNOX genes in leaf primordia (such as ASYMMETRIC LEAVES1, BLADE-ON-PETIOLE1, SAWTOOTH1, etc.). Thus, with this suppression, the levels of gibberellin increase and leaf primordium initiate growth.

The establishment of leaf dorsiventrality is important since the dorsal (adaxial) surface of the leaf is different from the ventral (abaxial) surface. [61]

Microscopy Edit

A. thaliana is well suited for light microscopy analysis. Young seedlings on the whole, and their roots in particular, are relatively translucent. This, together with their small size, facilitates live cell imaging using both fluorescence and confocal laser scanning microscopy. [62] By wet-mounting seedlings in water or in culture media, plants may be imaged uninvasively, obviating the need for fixation and sectioning and allowing time-lapse measurements. [63] Fluorescent protein constructs can be introduced through transformation. The developmental stage of each cell can be inferred from its location in the plant or by using fluorescent protein markers, allowing detailed developmental analysis.

Light sensing, light emission, and circadian biology Edit

The photoreceptors phytochromes A, B, C, D, and E mediate red light-based phototropic response. Understanding the function of these receptors has helped plant biologists understand the signaling cascades that regulate photoperiodism, germination, de-etiolation, and shade avoidance in plants.

The UVR8 protein detects UV-B light and mediates the response to this DNA-damaging wavelength.

A. thaliana was used extensively in the study of the genetic basis of phototropism, chloroplast alignment, and stomal aperture and other blue light-influenced processes. [64] These traits respond to blue light, which is perceived by the phototropin light receptors. Arabidopsis has also been important in understanding the functions of another blue light receptor, cryptochrome, which is especially important for light entrainment to control the plants' circadian rhythms. [65] When the onset of darkness is unusually early, A. thaliana reduces its metabolism of starch by an amount that effectively requires division. [66]

Light responses were even found in roots, previously thought to be largely insensitive to light. While the gravitropic response of A. thaliana root organs is their predominant tropic response, specimens treated with mutagens and selected for the absence of gravitropic action showed negative phototropic response to blue or white light, and positive response to red light, indicating that the roots also show positive phototropism. [67]

In 2000, Dr. Janet Braam of Rice University genetically engineered A. thaliana to glow in the dark when touched. The effect was visible to ultrasensitive cameras. [68]

Multiple efforts, including the Glowing Plant Project, have sought to use A. thaliana to increase plant luminescence intensity towards commercially viable levels.

On the Moon Edit

On January 2, 2019, China's Chang'e-4 lander brought A. thaliana to the moon. [69] A small microcosm 'tin' in the lander contained A. thaliana, seeds of potatoes, and silkworm eggs. As plants would support the silkworms with oxygen, and the silkworms would in turn provide the plants with necessary carbon dioxide and nutrients through their waste, [70] researchers will evaluate whether plants successfully perform photosynthesis, and grow and bloom in the lunar environment. [69]

Understanding how plants achieve resistance is important to protect the world's food production, and the agriculture industry. Many model systems have been developed to better understand interactions between plants and bacterial, fungal, oomycete, viral, and nematode pathogens. A. thaliana has been a powerful tool for the study of the subdiscipline of plant pathology, that is, the interaction between plants and disease-causing pathogens.

Pathogen type Example in A. thaliana
Bakterien Pseudomonas syringae, Xanthomonas campestris
Pilze Colletotrichum destructivum, Botrytis cinerea, Golovinomyces orontii
Oomycete Hyaloperonospora arabidopsidis
Viral Cauliflower mosaic virus (CaMV), tomato mosaic virus (TMV)
Nematode Meloidogyne incognita, Heterodera schachtii

Die Verwendung von A. thaliana has led to many breakthroughs in the advancement of knowledge of how plants manifest plant disease resistance. The reason most plants are resistant to most pathogens is through nonhost resistance - not all pathogens will infect all plants. An example where A. thaliana was used to determine the genes responsible for nonhost resistance is Blumeria graminis, the causal agent of powdery mildew of grasses. A. thaliana mutants were developed using the mutagen ethyl methanesulfonate and screened to identify mutants with increased infection by B. graminis. [72] [73] [74] The mutants with higher infection rates are referred to as PEN mutants due to the ability of B. graminis to penetrate A. thaliana to begin the disease process. Die PEN genes were later mapped to identify the genes responsible for nonhost resistance to B. graminis.

In general, when a plant is exposed to a pathogen, or nonpathogenic microbe, an initial response, known as PAMP-triggered immunity (PTI), occurs because the plant detects conserved motifs known as pathogen-associated molecular patterns (PAMPs). [75] These PAMPs are detected by specialized receptors in the host known as pattern recognition receptors (PRRs) on the plant cell surface.

The best-characterized PRR in A. thaliana is FLS2 (Flagellin-Sensing2), which recognizes bacterial flagellin, [76] [77] a specialized organelle used by microorganisms for the purpose of motility, as well as the ligand flg22, which comprises the 22 amino acids recognized by FLS2. Discovery of FLS2 was facilitated by the identification of an A. thaliana ecotype, Ws-0, that was unable to detect flg22, leading to the identification of the gene encoding FLS2. FLS2 shows striking similarity to rice XA21, the first PRR isolated in 1995

A second PRR, EF-Tu receptor (EFR), identified in A. thaliana, recognizes the bacterial EF-Tu protein, the prokaryotic elongation factor used in protein synthesis, as well as the laboratory-used ligand elf18. [78] Using Agrobakterium-mediated transformation, a technique that takes advantage of the natural process by which Agrobakterium transfers genes into host plants, the EFR gene was transformed into Nicotiana Benthamiana, tobacco plant that does not recognize EF-Tu, thereby permitting recognition of bacterial EF-Tu [79] thereby confirming EFR as the receptor of EF-Tu.

Both FLS2 and EFR use similar signal transduction pathways to initiate PTI. A. thaliana has been instrumental in dissecting these pathways to better understand the regulation of immune responses, the most notable one being the mitogen-activated protein kinase (MAP kinase) cascade. Downstream responses of PTI include callose deposition, the oxidative burst, and transcription of defense-related genes. [80]

PTI is able to combat pathogens in a nonspecific manner. A stronger and more specific response in plants is that of effector-triggered immunity (ETI), which is dependent upon the recognition of pathogen effectors, proteins secreted by the pathogen that alter functions in the host, by plant resistance genes (R-genes), often described as a gene-for-gene relationship. This recognition may occur directly or indirectly via a guardee protein in a hypothesis known as the guard hypothesis. The first R-gene cloned in A. thaliana war RPS2 (resistance to Pseudomonas syringae 2), which is responsible for recognition of the effector avrRpt2. [81] The bacterial effector avrRpt2 is delivered into A. thaliana via the Type III secretion system of P. syringae pv tomato strain DC3000. Recognition of avrRpt2 by RPS2 occurs via the guardee protein RIN4, which is cleaved . Recognition of a pathogen effector leads to a dramatic immune response known as the hypersensitive response, in which the infected plant cells undergo cell death to prevent the spread of the pathogen. [82]

Systemic acquired resistance (SAR) is another example of resistance that is better understood in plants because of research done in A. thaliana. Benzothiadiazol (BTH), a salicylic acid (SA) analog, has been used historically as an antifungal compound in crop plants. BTH, as well as SA, has been shown to induce SAR in plants. The initiation of the SAR pathway was first demonstrated in A. thaliana in which increased SA levels are recognized by nonexpresser of PR genes 1 (NPR1) [83] due to redox change in the cytosol, resulting in the reduction of NPR1. NPR1, which usually exists in a multiplex (oligomeric) state, becomes monomeric (a single unit) upon reduction. [84] When NPR1 becomes monomeric, it translocates to the nucleus, where it interacts with many TGA transcription factors, and is able to induce pathogen-related genes such as PR1. [85] Another example of SAR would be the research done with transgenic tobacco plants, which express bacterial salicylate hydroxylase, nahG gene, requires the accumulation of SA for its expression [86]

Although not directly immunological, intracellular transport affects susceptibility by incorporating - or being tricked into incorporating - pathogen particles. Zum Beispiel die Dynamin-related protein 2b/drp2b gene helps to move invaginated material into cells, with some mutants increasing PstDC3000 virulence even further. [87]

Evolutionary aspect of plant-pathogen resistance Edit

Plants are affected by multiple pathogens throughout their lifetimes. In response to the presence of pathogens, plants have evolved receptors on their cell surfaces to detect and respond to pathogens. [88] Arabidopsis thaliana is a model organism used to determine specific defense mechanisms of plant-pathogen resistance. [89] These plants have special receptors on their cell surfaces that allow for detection of pathogens and initiate mechanisms to inhibit pathogen growth. [89] They contain two receptors, FLS2 (bacterial flagellin receptor) and EF-Tu (bacterial EF-Tu protein), which use signal transduction pathways to initiate the disease response pathway. [89] The pathway leads to the recognition of the pathogen causing the infected cells to undergo cell death to stop the spread of the pathogen. [89] Plants with FLS2 and EF-Tu receptors have shown to have increased fitness in the population. [86] This has led to the belief that plant-pathogen resistance is an evolutionary mechanism that has built up over generations to respond to dynamic environments, such as increased predation and extreme temperatures. [86]

A. thaliana has also been used to study SAR. [90] This pathway uses benzothiadiazol, a chemical inducer, to induce transcription factors, mRNA, of SAR genes. This accumulation of transcription factors leads to inhibition of pathogen-related genes. [90]

Plant-pathogen interactions are important for an understanding of how plants have evolved to combat different types of pathogens that may affect them. [86] Variation in resistance of plants across populations is due to variation in environmental factors. Plants that have evolved resistance, whether it be the general variation or the SAR variation, have been able to live longer and hold off necrosis of their tissue (premature death of cells), which leads to better adaptation and fitness for populations that are in rapidly changing environments. [86] In the future, comparisons of the pathosystems of wild populations + their coevolved pathogens with wild-wild hybrids of known parentage may reveal new mechanisms of balancing selection. In life history theory we may find that A. thaliana maintains certain alleles due to pleitropy between plant-pathogen effects and other traits, as in livestock. [91]

Ongoing research on A. thaliana is being performed on the International Space Station by the European Space Agency. The goals are to study the growth and reproduction of plants from seed to seed in microgravity. [92] [93]

Plant-on-a-chip devices in which A. thaliana tissues can be cultured in semi-in vitro conditions have been described. [94] Use of these devices may aid understanding of pollen-tube guidance and the mechanism of sexual reproduction in A. thaliana.

Self-pollination Edit

A. thaliana is a predominantly self-pollinating plant with an outcrossing rate estimated at less than 0.3%. [95] An analysis of the genome-wide pattern of linkage disequilibrium suggested that self-pollination evolved roughly a million years ago or more. [96] Meioses that lead to self-pollination are unlikely to produce significant beneficial genetic variability. However, these meioses can provide the adaptive benefit of recombinational repair of DNA damages during formation of germ cells at each generation. [ Zitat benötigt ] Such a benefit may have been sufficient to allow the long-term persistence of meioses even when followed by self-fertilization. A physical mechanism for self-pollination in A. thaliana is through pre-anthesis autogamy, such that fertilisation takes place largely before flower opening.

    and NASC: [49] curated sources for diverse genetic and molecular biology information, links to gene expression databases [97] etc. (seed and DNA stocks) (seed and DNA stocks)
  1. ^ Warwick SI, Francis A, Al-Shehbaz IA (2016). "Brassicaceae species checklist and database". Species 2000 & ITIS Catalogue of Life (26 ed.). ISSN2405-8858.
  2. ^
  3. "Arabidopsis thaliana". Germplasm Resources Information Network (GRIN). Agricultural Research Service (ARS), United States Department of Agriculture (USDA) . Retrieved 11 December 2017 .
  4. ^
  5. Hoffmann MH (2002). "Biogeography of Arabidopsis thaliana (L.) Heynh. (Brassicaceae)". Zeitschrift für Biogeographie. 29: 125–134. doi:10.1046/j.1365-2699.2002.00647.x.
  6. ^
  7. Mitchell-Olds T (December 2001). "Arabidopsis thaliana and its wild relatives: a model system for ecology and evolution". Trends in Ökologie und Evolution. 16 (12): 693–700. doi:10.1016/s0169-5347(01)02291-1.
  8. ^
  9. Sharbel TF, Haubold B, Mitchell-Olds T (2000). "Genetic isolation by distance in Arabidopsis thaliana: biogeography and postglacial colonization of Europe". Molekulare Ökologie. 9 (12): 2109–2118. doi:10.1046/j.1365-294x.2000.01122.x. PMID11123622. S2CID1788832.
  10. ^ einB
  11. Krämer U (March 2015). "Planting molecular functions in an ecological context with Arabidopsis thaliana". eLife. 4: –06100. doi:10.7554/eLife.06100. PMC4373673 . PMID25807084.
  12. ^
  13. Durvasula A, Fulgione A, Gutaker RM, Alacakaptan SI, Flood PJ, Neto C, Tsuchimatsu T, Burbano HA, Picó FX, Alonso-Blanco C, Hancock AM (May 2017). "Arabidopsis thaliana". Proceedings of the National Academy of Sciences of the United States of America. 114 (20): 5213–5218. doi:10.1073/pnas.1616736114. PMC5441814 . PMID28473417.
  14. ^ einB
  15. "Genome Assembly". The Arabidopsis Information Resource . Retrieved 29 March 2016 .
  16. ^ Flora of NW Europe: Arabidopsis thalianaArchived 8 December 2007 at the Wayback Machine
  17. ^ Blamey, M. & Grey-Wilson, C. (1989). Flora of Britain and Northern Europe. 0-340-40170-2
  18. ^ Flora of Pakistan: Arabidopsis thaliana
  19. ^ Flora of China: Arabidopsis thaliana
  20. ^
  21. López-Bucio J, Campos-Cuevas JC, Hernández-Calderón E, Velásquez-Becerra C, Farías-Rodríguez R, Macías-Rodríguez LI, Valencia-Cantero E (February 2007). "Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin- and ethylene-independent signaling mechanism in Arabidopsis thaliana". Molecular Plant-Microbe Interactions. 20 (2): 207–17. doi: 10.1094/MPMI-20-2-0207 . PMID17313171.
  22. ^
  23. Meinke DW, Cherry JM, Dean C, Rounsley SD, Koornneef M (October 1998). "Arabidopsis thaliana: a model plant for genome analysis". Wissenschaft. 282 (5389): 662, 679–82. Bibcode:1998Sci. 282..662M. CiteSeerX10.1.1.462.4735 . doi:10.1126/science.282.5389.662. PMID9784120.
  24. ^ einB
  25. The 1001 Genomes Consortium (July 2016). "1,135 Genomes Reveal the Global Pattern of Polymorphism in Arabidopsis thaliana". Zelle. 166 (2): 481–491. doi:10.1016/j.cell.2016.05.063. PMC4949382 . PMID27293186.
  26. ^
  27. "Arabidopsis thaliana (L.) Heynh". www.gbif.org . Retrieved 8 December 2018 .
  28. ^
  29. Hedberg, Olov (1957). "Afroalpine Vascular Plants: A Taxonomic Revision". Acta Universitatis Upsaliensis: Symbolae Botanicae Upsalienses. 15 (1): 1–144.
  30. ^
  31. Fulgione A, Hancock AM (September 2018). "Archaic lineages broaden our view on the history of Arabidopsis thaliana". The New Phytologist. 219 (4): 1194–1198. doi: 10.1111/nph.15244 . PMID29862511.
  32. ^ einB
  33. "Arabidopsis thaliana – Overview". Enzyklopädie des Lebens.
  34. ^
  35. Exposito-Alonso M, Becker C, Schuenemann VJ, Reiter E, Setzer C, Slovak R, Brachi B, Hagmann J, Grimm DG, Chen J, Busch W, Bergelson J, Ness RW, Krause J, Burbano HA, Weigel D (February 2018). "The rate and potential relevance of new mutations in a colonizing plant lineage". PLOS Genetics. 14 (2): e1007155. doi:10.1371/journal.pgen.1007155. PMC5825158 . PMID29432421.
  36. ^
  37. "Arabidopsis thaliana (thale cress)". Kew Gardens.
  38. ^
  39. "State and Federal Noxious Weeds List | USDA PLANTS". plants.sc.egov.usda.gov . Retrieved 8 December 2018 .
  40. ^
  41. "IRMNG". Enzyklopädie des Lebens. Archived from the original on 1 April 2018.
  42. ^[1] TAIR: About Arabidopsis
  43. ^
  44. Rensink WA, Buell CR (June 2004). "Arabidopsis to rice. Applying knowledge from a weed to enhance our understanding of a crop species". Pflanzenphysiologie. 135 (2): 622–9. doi:10.1104/pp.104.040170. PMC514098 . PMID15208410.
  45. ^
  46. Coelho SM, Peters AF, Charrier B, Roze D, Destombe C, Valero M, Cock JM (December 2007). "Complex life cycles of multicellular eukaryotes: new approaches based on the use of model organisms". Gen. 406 (1–2): 152–70. doi:10.1016/j.gene.2007.07.025. PMID17870254.
  47. ^
  48. Platt A, Horton M, Huang YS, Li Y, Anastasio AE, Mulyati NW, Agren J, Bossdorf O, Byers D, Donohue K, Dunning M, Holub EB, Hudson A, Le Corre V, Loudet O, Roux F, Warthmann N, Weigel D, Rivero L, Scholl R, Nordborg M, Bergelson J, Borevitz JO (February 2010). Novembre J (ed.). "The scale of population structure in Arabidopsis thaliana". PLOS Genetics. 6 (2): e1000843. doi:10.1371/journal.pgen.1000843. PMC2820523 . PMID20169178.
  49. ^
  50. Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA, Meyerowitz EM (July 1990). "The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors". Natur. 346 (6279): 35–9. Bibcode:1990Natur.346. 35Y. doi:10.1038/346035a0. PMID1973265. S2CID4323431.
  51. ^ einB
  52. Meyerowitz EM (January 2001). "Prehistory and history of Arabidopsis research". Pflanzenphysiologie. 125 (1): 15–9. doi:10.1104/pp.125.1.15. PMC1539315 . PMID11154286.
  53. ^
  54. "About AIS". The Arabidopsis Information Resource. 8 November 2018 . Retrieved 25 April 2021 .
  55. ^
  56. Lloyd AM, Barnason AR, Rogers SG, Byrne MC, Fraley RT, Horsch RB (October 1986). "Transformation of Arabidopsis thaliana mit Agrobacterium tumefaciens". Wissenschaft. 234 (4775): 464–6. Bibcode:1986Sci. 234..464L. doi:10.1126/science.234.4775.464. PMID17792019. S2CID22125701.
  57. ^
  58. Chang C, Meyerowitz EM (March 1986). "Molecular cloning and DNA sequence of the Arabidopsis thaliana alcohol dehydrogenase gene". Proceedings of the National Academy of Sciences of the United States of America. 83 (5): 1408–12. Bibcode: 1986PNAS. 83.1408C. doi:10.1073/pnas.83.5.1408. PMC323085 . PMID2937058.
  59. ^ einB
  60. "Arabidopsis thaliana chloroplast, complete genome — NCBI accession number NC_000932.1". National Center for Biotechnology Information . Retrieved 4 November 2018 .
  61. ^ einB
  62. Sato S, Nakamura Y, Kaneko T, Asamizu E, Tabata S (1999). "Complete structure of the chloroplast genome of Arabidopsis thaliana". DNA Research. 6 (5): 283–290. doi: 10.1093/dnares/6.5.283 . ISSN1340-2838. PMID10574454.
  63. ^
  64. Bennett MD, Leitch IJ, Price HJ, Johnston JS (April 2003). "Comparisons with Caenorhabditis (approximately 100 Mb) and Drosophila (approximately 175 Mb) using flow cytometry show genome size in Arabidopsis to be approximately 157 Mb, thus approximately 25% larger than the Arabidopsis genome initiative estimate of approximately 125 Mb". Annalen der Botanik. 91 (5): 547–57. doi:10.1093/aob/mcg057. PMC4242247 . PMID12646499.
  65. ^ (Leutwileret al., 1984). In our survey Arabidopsis .
  66. ^
  67. Fleischmann A, Michael TP, Rivadavia F, Sousa A, Wang W, Temsch EM, Greilhuber J, Müller KF, Heubl G (December 2014). "Evolution of genome size and chromosome number in the carnivorous plant genus Genlisea (Lentibulariaceae), with a new estimate of the minimum genome size in angiosperms". Annalen der Botanik. 114 (8): 1651–63. doi:10.1093/aob/mcu189. PMC4649684 . PMID25274549.
  68. ^
  69. The Arabidopsis Genome Initiative (December 2000). "Analysis of the genome sequence of the flowering plant Arabidopsis thaliana". Natur. 408 (6814): 796–815. Bibcode:2000Natur.408..796T. doi: 10.1038/35048692 . PMID11130711.
  70. ^
  71. "TAIR - Genome Annotation".
  72. ^
  73. "Details - Arabidopsis_thaliana - Ensembl Genomes 63". ensembl.gramene.org . Retrieved 15 June 2021 .
  74. ^
  75. "Arabidopsis thaliana (Mouse-ear cress)". www.uniprot.org . Retrieved 15 June 2021 .
  76. ^
  77. Cheng, Chia-Yi Krishnakumar, Vivek Chan, Agnes P. Thibaud-Nissen, Françoise Schobel, Seth Town, Christopher D. (2017). "Araport11: a complete reannotation of the Arabidopsis thaliana reference genome". Das Pflanzenjournal. 89 (4): 789–804. doi:10.1111/tpj.13415. ISSN1365-313X.
  78. ^
  79. "Arabidopsis thaliana ecotype Col-0 mitochondrion, complete genome — NCBI accession number BK010421". National Center for Biotechnology Information . Retrieved 10 April 2019 .
  80. ^
  81. Klein M, Eckert-Ossenkopp U, Schmiedeberg I, Brandt P, Unseld M, Brennicke A, Schuster W (1994). "Physical mapping of the mitochondrial genome of Arabidopsis thaliana by cosmid and YAC clones". Plant Journal. 6 (3): 447–455. doi: 10.1046/j.1365-313X.1994.06030447.x . PMID7920724.
  82. ^
  83. Gualberto JM, Mileshina D, Wallet C, Niazi AK, Weber-Lotfi F, Dietrich A (2014). "The plant mitochondrial genome: dynamics and maintenance". Biochemie. 100: 107–120. doi:10.1016/j.biochi.2013.09.016. PMID24075874.
  84. ^
  85. Clough SJ, Bent AF (December 1998). "Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana". Das Pflanzenjournal. 16 (6): 735–43. doi:10.1046/j.1365-313x.1998.00343.x. PMID10069079.
  86. ^
  87. Zhang X, Henriques R, Lin SS, Niu QW, Chua NH (2006). "Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method". Naturprotokolle. 1 (2): 641–6. doi:10.1038/nprot.2006.97. PMID17406292. S2CID6906570.
  88. ^
  89. "T-DNA Express: Arabidopsis Gene Mapping Tool". signal.salk.edu.
  90. ^ einBC
  91. "Eurasian Arabidopsis Stock Centre (uNASC)". arabidopsis.info.
  92. ^
  93. Magliano TM, Botto JF, Godoy AV, Symonds VV, Lloyd AM, Casal JJ (June 2005). "New Arabidopsis recombinant inbred lines (Landsberg erecta x Nossen) reveal natural variation in phytochrome-mediated responses". Pflanzenphysiologie. 138 (2): 1126–35. doi:10.1104/pp.104.059071. PMC1150426 . PMID15908601.
  94. ^
  95. "ABRC". abrc.osu.edu.
  96. ^
  97. "NASC Collection Info". arabidopsis.info.
  98. ^
  99. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP (2017). "Arabidopsis thaliana". Grenzen in der Pflanzenwissenschaft. 8: 39. doi:10.3389/fpls.2017.00039. PMC5258748 . PMID28174584.
  100. ^
  101. Hahn F, Eisenhut M, Mantegazza O, Weber AP (5 April 2018). "Arabidopsis With Cas9-Based Gene Targeting". Grenzen in der Pflanzenwissenschaft. 9: 424. doi:10.3389/fpls.2018.00424. PMC5895730 . PMID29675030.
  102. ^
  103. Lolle SJ, Victor JL, Young JM, Pruitt RE (March 2005). "Genome-wide non-mendelian inheritance of extra-genomic information in Arabidopsis". Natur. 434 (7032): 505–9. Bibcode:2005Natur.434..505L. doi:10.1038/nature03380. PMID15785770. S2CID1352368. Washington Post summary.
  104. ^
  105. Peng P, Chan SW, Shah GA, Jacobsen SE (September 2006). "Plant genetics: increased outcrossing in hothead mutants". Natur. 443 (7110): E8, discussion E8–9. Bibcode:2006Natur.443E. 8P. doi: 10.1038/nature05251 . PMID17006468. S2CID4420979.
  106. ^
  107. Pennisi E (September 2006). "Genetics. Pollen contamination may explain controversial inheritance". Wissenschaft. 313 (5795): 1864. doi:10.1126/science.313.5795.1864. PMID17008492. S2CID82215542.
  108. ^
  109. Coen ES, Meyerowitz EM (September 1991). "The war of the whorls: genetic interactions controlling flower development". Natur. 353 (6339): 31–7. Bibcode:1991Natur.353. 31C. doi:10.1038/353031a0. PMID1715520. S2CID4276098.
  110. ^
  111. Tsukaya H (7 June 2013). "Leaf development". The Arabidopsis Book. 11: e0163. doi:10.1199/tab.0163. PMC3711357 . PMID23864837.
  112. ^
  113. Turner S, Sieburth LE (22 March 2003). "Vascular patterning". The Arabidopsis Book. 2: e0073. doi:10.1199/tab.0073. PMC3243335 . PMID22303224.
  114. ^
  115. Efroni I, Eshed Y, Lifschitz E (April 2010). "Morphogenesis of simple and compound leaves: a critical review". Die Pflanzenzelle. 22 (4): 1019–32. doi:10.1105/tpc.109.073601. PMC2879760 . PMID20435903.
  116. ^ Moreno N, Bougourd S, Haseloff J and Fiejo JA. 2006. Chapter 44: Imaging Plant Cells. In: Pawley JB (Editor). Handbook of Biological Confocal Microscopy - 3rd edition. SpringerScience+Business Media, New York. p769-787
  117. ^
  118. Shaw SL (February 2006). "Imaging the live plant cell". Das Pflanzenjournal. 45 (4): 573–98. doi:10.1111/j.1365-313X.2006.02653.x. PMID16441350.
  119. ^
  120. Sullivan JA, Deng XW (August 2003). "From seed to seed: the role of photoreceptors in Arabidopsis development". Entwicklungsbiologie. 260 (2): 289–97. doi:10.1016/S0012-1606(03)00212-4. PMID12921732.
  121. ^
  122. Más P (2005). "Circadian clock signaling in Arabidopsis thaliana: from gene expression to physiology and development". The International Journal of Developmental Biology. 49 (5–6): 491–500. doi: 10.1387/ijdb.041968pm . PMID16096959.
  123. ^
  124. Scialdone A, Mugford ST, Feike D, Skeffington A, Borrill P, Graf A, Smith AM, Howard M (June 2013). "Arabidopsis plants perform arithmetic division to prevent starvation at night". eLife. 2: e00669. arXiv: 1306.5148 . doi:10.7554/eLife.00669. PMC3691572 . PMID23805380.
  125. ^
  126. Ruppel NJ, Hangarter RP, Kiss JZ (February 2001). "Red-light-induced positive phototropism in Arabidopsis roots". Planta. 212 (3): 424–30. doi:10.1007/s004250000410. PMID11289607. S2CID28410755.
  127. ^"Plants that Glow in the Dark", Bioresearch Online, 18 May 2000
  128. ^ einB
  129. Letzter, Rafi (4 January 2019). "There Are Plants and Animals on the Moon Now (Because of China)". Space.com . Retrieved 15 January 2019 .
  130. ^
  131. Connor, Neil (13 April 2018). "China plans to grow flowers and silkworms on the dark side of the moon". Der Telegraph. ISSN0307-1235 . Retrieved 15 January 2019 .
  132. ^ Hassani, M.A., Durán, P. and Hacquard, S. (2018) "Microbial interactions within the plant holobiont". Mikrobiom, 6(1): 58. doi:10.1186/s40168-018-0445-0. Material was copied from this source, which is available under a Creative Commons Attribution 4.0 International License
  133. ^
  134. Collins NC, Thordal-Christensen H, Lipka V, Bau S, Kombrink E, Qiu JL, Hückelhoven R, Stein M, Freialdenhoven A, Somerville SC, Schulze-Lefert P (October 2003). "SNARE-protein-mediated disease resistance at the plant cell wall". Natur. 425 (6961): 973–7. Bibcode:2003Natur.425..973C. doi:10.1038/nature02076. PMID14586469. S2CID4408024.
  135. ^
  136. Lipka V, Dittgen J, Bednarek P, Bhat R, Wiermer M, Stein M, Landtag J, Brandt W, Rosahl S, Scheel D, Llorente F, Molina A, Parker J, Somerville S, Schulze-Lefert P (November 2005). "Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis". Wissenschaft. 310 (5751): 1180–3. Bibcode:2005Sci. 310.1180L. doi:10.1126/science.1119409. hdl: 11858/00-001M-0000-0012-3A32-0 . PMID16293760. S2CID35317665.
  137. ^
  138. Stein M, Dittgen J, Sánchez-Rodríguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, Somerville S (March 2006). "Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration". Die Pflanzenzelle. 18 (3): 731–46. doi:10.1105/tpc.105.038372. PMC1383646 . PMID16473969.
  139. ^
  140. Knepper C, Day B (March 2010). "From perception to activation: the molecular-genetic and biochemical landscape of disease resistance signaling in plants". The Arabidopsis Book. 8: e012. doi:10.1199/tab.0124. PMC3244959 . PMID22303251.
  141. ^
  142. Gómez-Gómez L, Felix G, Boller T (May 1999). "A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana". Das Pflanzenjournal. 18 (3): 277–84. doi: 10.1046/j.1365-313X.1999.00451.x . PMID10377993.
  143. ^
  144. Gómez-Gómez L, Boller T (June 2000). "FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis". Molekulare Zelle. 5 (6): 1003–11. doi:10.1016/S1097-2765(00)80265-8. PMID10911994.
  145. ^
  146. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JD, Boller T, Felix G (May 2006). "Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation". Zelle. 125 (4): 749–60. doi:10.1016/j.cell.2006.03.037. PMID16713565. S2CID6856390.
  147. ^
  148. Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, Smoker M, Rallapalli G, Thomma BP, Staskawicz B, Jones JD, Zipfel C (April 2010). "Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance". Natur Biotechnologie. 28 (4): 365–9. doi:10.1038/nbt.1613. PMID20231819. S2CID7260214. ,
  149. ^
  150. Zhang J, Zhou JM (September 2010). "Plant immunity triggered by microbial molecular signatures". Molecular Plant. 3 (5): 783–93. doi:10.1093/mp/ssq035. PMID20713980.
  151. ^
  152. Kunkel BN, Bent AF, Dahlbeck D, Innes RW, Staskawicz BJ (August 1993). "RPS2, an Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains expressing the avirulence gene avrRpt2". Die Pflanzenzelle. 5 (8): 865–75. doi:10.1105/tpc.5.8.865. PMC160322 . PMID8400869.
  153. ^
  154. Axtell MJ, Staskawicz BJ (February 2003). "Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4". Zelle. 112 (3): 369–77. doi:10.1016/S0092-8674(03)00036-9. PMID12581526. S2CID1497625.
  155. ^
  156. Cao H, Bowling SA, Gordon AS, Dong X (November 1994). "Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance". Die Pflanzenzelle. 6 (11): 1583–1592. doi:10.1105/tpc.6.11.1583. PMC160545 . PMID12244227.
  157. ^
  158. Mou Z, Fan W, Dong X (June 2003). "Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes". Zelle. 113 (7): 935–44. doi:10.1016/S0092-8674(03)00429-X. PMID12837250. S2CID1562690.
  159. ^
  160. Johnson C, Boden E, Arias J (August 2003). "Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis". Die Pflanzenzelle. 15 (8): 1846–58. doi:10.1105/tpc.012211. PMC167174 . PMID12897257.
  161. ^ einBCDe
  162. Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, Ryals J (November 1994). "A central role of salicylic Acid in plant disease resistance". Wissenschaft. 266 (5188): 1247–50. Bibcode: 1994Sci. 266.1247D. doi:10.1126/science.266.5188.1247. PMID17810266. S2CID15507678.
  163. ^
  164. Ben Khaled, Sara Postma, Jelle Robatzek, Silke (4 August 2015). "A Moving View: Subcellular Trafficking Processes in Pattern Recognition Receptor–Triggered Plant Immunity". Annual Review of Phytopathology. Annual Reviews. 53 (1): 379–402. doi:10.1146/annurev-phyto-080614-120347. ISSN0066-4286.
  165. ^
  166. Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giraudat J, Leung J, Staskawicz BJ (September 1994). "RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes". Wissenschaft. 265 (5180): 1856–60. Bibcode: 1994Sci. 265.1856B. doi:10.1126/science.8091210. PMID8091210.
  167. ^ einBCD
  168. Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JD, Felix G, Boller T (April 2004). "Bacterial disease resistance in Arabidopsis through flagellin perception". Natur. 428 (6984): 764–7. Bibcode:2004Natur.428..764Z. doi:10.1038/nature02485. PMID15085136. S2CID4332562.
  169. ^ einB
  170. Lawton K, Friedrich L, Hunt M (1996). "Benzothiadizaole induces disease resistance by a citation of the systemic acquired resistance signal transduction pathway". Das Pflanzenjournal. 10 (1): 71–82. doi: 10.1046/j.1365-313x.1996.10010071.x . PMID8758979.
  171. ^
  172. Fridman, Eyal (2015). "Consequences of hybridization and heterozygosity on plant vigor and phenotypic stability". Plant Science. Sonst. 232: 35–40. doi:10.1016/j.plantsci.2014.11.014. ISSN0168-9452.
  173. ^
  174. Link BM, Busse JS, Stankovic B (2014). "Seed-to-Seed-to-Seed Growth and Development of Arabidopsis in Microgravity". Astrobiology. 14 (10): 866–875. Bibcode:2014AsBio..14..866L. doi:10.1089/ast.2014.1184. PMC4201294 . PMID25317938.
  175. ^
  176. Ferl RJ, Paul AL (April 2010). "Lunar plant biology--a review of the Apollo era". Astrobiology. 10 (3): 261–74. Bibcode:2010AsBio..10..261F. doi:10.1089/ast.2009.0417. PMID20446867.
  177. ^
  178. Yetisen AK, Jiang L, Cooper JR, Qin Y, Palanivelu R, Zohar Y (May 2011). "A microsystem-based assay for studying pollen tube guidance in plant reproduction". J. Micromech. Microeng. 25 (5): 054018. Bibcode:2011JMiMi..21e4018Y. doi:10.1088/0960-1317/21/5/054018. CS1-Wartung: verwendet Autorenparameter (Link)
  179. ^
  180. Abbott RJ, Gomes MF (1989). "Population genetic structure and outcrossing rate of Arabidopsis thaliana (L.) Heynh". Vererbung. 62 (3): 411–418. doi: 10.1038/hdy.1989.56 .
  181. ^
  182. Tang C, Toomajian C, Sherman-Broyles S, Plagnol V, Guo YL, Hu TT, Clark RM, Nasrallah JB, Weigel D, Nordborg M (August 2007). "The evolution of selfing in Arabidopsis thaliana". Wissenschaft. 317 (5841): 1070–2. Bibcode:2007Sci. 317.1070T. doi:10.1126/science.1143153. PMID17656687. S2CID45853624.
  183. ^http://www.arabidopsis.org/portals/expression/microarray/microarrayDatasetsV2.jsp
    Media related to Arabidopsis thaliana at Wikimedia Commons Featured article in Genome News Network - A comprehensive review published yearly related to research in Arabidopsis

160 ms 9.0% recursiveClone 140 ms 7.9% Scribunto_LuaSandboxCallback::gsub 100 ms 5.6% Scribunto_LuaSandboxCallback::callParserFunction 80 ms 4.5% Scribunto_LuaSandboxCallback::expandTemplate 80 ms 4.5% Scribunto_LuaSandboxCallback::sub 80 ms 4.5% Scribunto_LuaSandboxCallback::find 60 ms 3.4% Scribunto_LuaSandboxCallback::getAllExpandedArguments 40 ms 2.2% [others] 480 ms 27.0% Number of Wikibase entities loaded: 38/400 -->


Verweise

Enserink, M. 2013. To stop malaria, infect the mosquitoes. Science Now (9 May 2013), http://www.sciencemag.org/news/2013/05/stop-malaria-infect-mosquitoes.

Francis, J. W. 2003. The organosubstrate of life: a creationist perspective of microbes and viruses. In Proceedings of the Fifth International Conference on Creationism, Hrsg. R. L. Ivey, pp. 434–444. Pittsburgh, Pennsylvania: Creation Science Fellowship.

Gardner, M. J., N. Hall, E. Fung, O. White, M. Berriman, R. W. Hyman, J. M. Carlton, et al. 2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Natur 419:498–511 doi:10.1038/nature01097 in Plasmodium genomics special issue, 3 October 2002.

Gillen, A. L. 2013. Parasitology Lab Manual, 2. Auflage. Kearney, Nebraska: RL Simonson Studios.

Gillen, A. L. 2007. The Genesis of Germs: Disease and the Coming Plagues in a Fallen World. Green Forest, Arkansas: Master Books.

Kalanon, M. and G. McFadden. 2010. Malaria, Plasmodium falciparum, and its apicoplast. Biochemical Society transactions 38(3):775–82. doi: 10.1042/BST0380775. Retrieved from liberty.illiad.oclc.org.

Marquardt, W. C., R. S. Demaree, and R. B. Grieve. 2000. Parasitology and Vector Biology, 2. Auflage. San Diego, California: Harcourt Academic Press.

Perry, A. 2011. Lifeblood. New York: PublicAffairs.

Roberts, L. S., J. Janovy, Jr., and S. Nadler. 2013. Schmidt and Roberts’ Foundations of Parasitology, 9th edition. Boston, Massachusetts: WCB McGraw-Hill.

Shah, S. 2011. The Fever: How Malaria Has Ruled Humankind for 500,000 Years (reprint edition). New York: Picador.

Short, A. R. 1955. The Bible and Modern Medicine. London: The Paternoster Press.

Smith, D. 2013. Steal my sunshine. Der Wissenschaftler 27:35–40.

Smyth, J. D. 1976. Introduction to Animal Parasitology. London: Hodder and Stoughton.

Spielman, A. and M. D’Antonio, 2001. Mosquito: A Natural History of Our Most Persistent and Deadly Foe, 1st edition. New York: Hyperion.

Tortora, G. J., B. R. Funke, and C. L. Case. 2013. Microbiology, An Introduction,11th edition. San Francisco, Kalifornien: Pearson Benjamin/Cummings Pub. Co.


Schau das Video: Tutorial: Rosetten selber machen (Januar 2023).