Information

Was ist der Unterschied zwischen Mutation pro Basenpaar und Mutation pro Genom?

Was ist der Unterschied zwischen Mutation pro Basenpaar und Mutation pro Genom?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ist die Genomgröße nicht die Anzahl der Basenpaare, die in der DNA vorhanden sind? Was ist also der Unterschied zwischen der Mutation pro Basenpaar und der Mutation pro Genom? Sind sie ähnlich oder verschieden?


Sie sind unterschiedliche Normalisierungen derselben Zahl. Es ist die Frage, ob Sie wissen möchten, wie viele Mutationen an einer einzelnen Position in einem Genom zu erwarten sind, oder ob Sie wissen möchten, wie viele Mutationen im gesamten Genom vorkommen.

Siehe Wikipedia, zum Beispiel:

Für jede dieser Raten gibt es mehrere natürliche Zeiteinheiten, wobei die Raten entweder als Mutationen pro Basenpaar pro Zellteilung, pro Gen pro Generation oder pro Genom pro Generation charakterisiert werden.

Mutationen pro Genom ist die Anzahl der Mutationen pro Basenpaar mal der Anzahl der Basenpaare im Genom (plus Mutationen, die nicht Basenpaarsubstitutionen entsprechen, obwohl sie bei diesen Messungen normalerweise ignoriert werden).

Z.B., $10^{-9}$ Mutationen pro Basenpaar in einem Genom von 3 Milliarden Basenpaaren entsprechen $3$ Mutationen pro Genom.


Mutationsrate

In der Genetik ist die Mutationsrate ist ein Maß für die Rate, mit der verschiedene Arten von Mutationen während einer bestimmten Zeiteinheit auftreten. Mutationsraten werden typischerweise für eine spezifische Mutationsklasse angegeben, zum Beispiel Punktmutationen, kleine oder große Insertionen oder Deletionen. Die Substitutionsrate kann weiter in ein Mutationsspektrum unterteilt werden, das den Einfluss des genetischen Kontextes auf die Mutationsrate beschreibt.

Für jede dieser Raten gibt es mehrere natürliche Zeiteinheiten, wobei die Raten entweder als Mutationen pro Basenpaar pro Zellteilung, pro Gen pro Generation oder pro Genom pro Generation charakterisiert werden. Die Mutationsrate eines Organismus ist ein evolviertes Merkmal und wird neben starken Einflüssen durch die Umwelt stark von der Genetik jedes Organismus beeinflusst. Die Ober- und Untergrenzen, bis zu denen sich Mutationsraten entwickeln können, sind Gegenstand laufender Untersuchungen.


Abschätzung der Mutationsrate pro Basenpaar in der Hefe Saccharomyces cerevisiae

Obwohl Mutationsraten eine wichtige Determinante für die Evolutionsrate sind, sind sie schwer genau zu messen, und globale Mutationsraten (Mutationen pro Genom pro Generation) werden oft aus der Mutationsrate pro Basenpaar extrapoliert, vorausgesetzt, die Mutationsrate ist im gesamten Genom gleich . Unter Verwendung von Knospungshefe beschreiben wir eine verbesserte Methode zur genauen Berechnung von Mutationsraten basierend auf dem Fluktuationsassay. Unsere Analyse legt nahe, dass sich die Mutationsraten pro Basenpaar bei zwei Genen signifikant unterscheiden (3.8031010beiURA3und 6.4431010beiCAN1) und schlagen eine Definition für die effektive Zielgröße vor von Genen (die Wahrscheinlichkeit, dass eine Mutation das Gen inaktiviert), die anerkennt, dass die Mutationsrate im gesamten Genom uneinheitlich ist.

Evolution. Es begrenzt die Anpassungsgeschwindigkeit in Populationen mit nützlichen Mutationen, in Abwesenheit von nützlichen Mutationen stellt es die Gleichgewichtsfitness der Population ein. Trotz seiner Bedeutung gibt es große Unsicherheiten bei den Schätzungen der Genom-Mutationsrate pro Generation. Die Schätzung dieses Parameters erfolgt typischerweise in drei Schritten: Bestimmung der Mutationsrate zu einem bestimmten Phänotyp, Umrechnung dieser phänotypischen Rate in eine Mutationsrate pro Basenpaar in einem bestimmten Gen und Extrapolation dieser lokalen Rate auf das gesamte Genom. In diesem Artikel konzentrieren wir uns auf die technische Herausforderung, phänotypische Mutationsraten genau zu bestimmen, und die analytische Aufgabe, die effektive Zielgröße eines Gens zu bestimmen, die Wahrscheinlichkeit, dass eine Mutation irgendwo in einem definierten Abschnitt des Genoms a Mutation mit einem bestimmten phänotypischen Effekt.

Drei Methoden werden üblicherweise verwendet, um phänotypische Mutationsraten zu messen: Mutations-Akkumulations-Assays, Mutanten-Akkumulations-Assays und Fluktuations-Assays. Der Mutationsakkumulations-Assay beinhaltet das Passieren einer Kultur durch wiederkehrende Engpässe, idealerweise einer einzelnen Zelle/Individuum, so dass alle Mutationen nahezu neutral sind. Dies ist nützlich, um die Mutationsrate zu bestimmen, die die Fitness beeinflusst, da wiederholte Engpässe den Selektionseffekt reduzieren (Kibotaand Lynch1996, Zeyl und Devisser2001). Dieses Verfahren funktioniert gut bei mehrzelligen Organismen, bei denen die Populationsgröße am Engpass gehalten werden kann, bei Mikroorganismen, bei denen die Bildung einer sichtbaren Kolonie zugelassen werden muss, findet jedoch immer noch eine Selektion zwischen den Engpässen statt. Mehrere

Methoden zur Abschätzung der phänotypischen Mutationsraten aus Mutamuta-Akkumulations-Assays (Garcia-Dorado und Gallego 2003) stehen alternativ zur direkten Sequenzierung zur Verfügung, da alle Mutationen im gleichen Genom vorkommen (Denveret al.2004 Haag -Liautardet al. 2007).

Im Mutantenakkumulationsassay wird die Häufigkeit eines Phänotyps, der in der Umgebung des Experiments neutral ist, aber in einer alternativen Umgebung selektiert werden kann, in einer exponentiell wachsenden Kultur überwacht, indem periodisch ein Aliquot der Kultur auf selektives Medium ausplattiert wird . Sobald die Population eine solche Größe erreicht hat, dass die Wahrscheinlichkeit für das Auftreten einer neuen Mutation in der nächsten Generation ungefähr eins beträgt, wird die Häufigkeit der Mutanten linear mit der Zeit ansteigen. Somit erfordert eine genaue Schätzung der phänotypischen Mutationsrate lange Intervalle zwischen Frequenzmessungen und diese experimentellen Messungen dauern typischerweise Hunderte von Generationen. Da der größte Teil der Bevölkerung die neutrale Mutation nicht akkumuliert hat, treten vorteilhafte Mutationen hauptsächlich in Zellen auf, denen die neutrale Mutation fehlt, wodurch die Akkumulation von Mutanten verlangsamt wird.

Beim Fluktuationsassay werden viele Parallelkulturen mit einer kleinen Anzahl von Zellen inokuliert, unter nichtselektiven Bedingungen gezüchtet und zur Selektion auf Mutanten ausplattiert (Luria und Delbru¨ ck1943). Die Anzahl der Mutationen, die in jeder Kultur auftreten, folgt der Poisson-Verteilung, jedoch wird die Anzahl der mutierten Zellen pro Kultur stark variieren, da frühe Mutationen zu „Jackpots“ führen, also Kulturen, die sehr viele mutierte Individuen enthalten.

Der einfachste Weg, die erwartete Anzahl von Mutationen, die in jeder Kultur (m) auftreten, abzuschätzen, ist der Anteil der Kulturen mit null Mutanten, der em . sein sollte. Diese Methode (

P0) wurde von Luria und Delbrück (1943) in ihrem ursprünglichen Artikel verwendet, in dem die Fluktuation-1 . beschrieben wurdeKorrespondierender Autor:Institut für Molekular- und Zellbiologie,

Harvard University, 16 Divinity Ave., Raum 3000, Cambridge, MA 02138. E-Mail: [email protected]

Test. Die vollständige Verteilung der Mutanten pro Kultur (die Luria-Delbrück-Verteilung) kann durch einen Satz rekursiver Gleichungen beschrieben werden (Maet al.1992). Die genaueste Methode zum Schätzenm (Ma-Sandri-Sarkar-Maximum-Likelihood) findet diejenige, die die Luria-Delbru¨ck-Verteilung am besten an die Daten anpasst (Sarkar et al.1992 Roscheand Foster 2000). Durch Simulation berechnet Stewart (1994) 95 %-Konfidenzintervalle, die mit dieser Methode erhalten wurden. Damit die Konfidenzintervalle jedoch aussagekräftig sind, müssen die Daten der Luria-Delbrück-Verteilung folgen.

Eine Möglichkeit, die Qualität der Daten abzuschätzen, besteht darin, die kumulative Verteilung der Mutantenhäufigkeit in einem Log-Log-Plot darzustellen. Auf diese Weise präsentierte Luria-Delbru¨ck-verteilte Daten erzeugen eine Gerade mit Steigung 1 (Roscheand Foster 2000). Abweichungen von der Linearität zeigen, dass die Daten keine Luria-Delbrück-Verteilung nähern. Dieser grafische Ansatz ignoriert Jackpots (da sie weit weg von der Linie liegen) und Kulturen mit null Mutanten (aufgrund der logarithmischen Transformation). In diesem Artikel stellen wir einen simulationsbasierten Ansatz zur Bestimmung der Datenqualität von Fluktuationsanalysen vor und zeigen, wie diese Methode Abweichungen von der Luria-Delbrück-Verteilung erkennen kann.

Um phänotypische Mutationsraten in eine Mutationsrate pro Basenpaar umzuwandeln, müssen wir die effektive Zielgröße für die phänotypische Mutation schätzen. Obwohl das Konzept der effektiven Zielgröße in der Evolutionstheorie wichtig ist – es verknüpft die Mutationsrate mit einem bestimmten Phänotyp mit der Mutationsrate pro Genom pro Generation – wurde es nicht explizit definiert. Frühere Arbeiten haben „Zielgröße“ verwendet, um sich auf die Größe des Gens zu beziehen, in dem Mutationen selektiert werden (Drake1991), könnte aber auch die Anzahl der nachweisbaren Mutationen innerhalb eines Reporters beschreiben. Wir schlagen eine allgemeinere und wahrscheinlichere Definition der effektiven Zielgröße vor, die die Beziehung zwischen phänotypischen und genomischen Mutationsraten umfasst. Unsere Definition zeigt, wo Unsicherheiten bei Schätzungen der genomischen Mutationsrate auftreten und zeigt, wie dieser Parameter aus experimentellen Daten berechnet werden kann. Insbesondere unterscheiden wir zwischen der effektiven Zielgröße basierend auf der durchschnittlichen Mutationsrate pro Genom und der lokusspezifischen effektiven Zielgröße bedingt durch ein Mutationsereignis, das in einer bestimmten Region des Genoms auftritt.

Wir haben die Mutationsraten für Resistenz gegenüber 5-Fluororotsäure (5-FOA), Canavanin und a-Faktor gemessen. 5-FOA ist nicht toxisch, kann aber über den Uracil-Biosyntheseweg in toxisches 5-Fluor-uracil umgewandelt werden. Das Produkt des URA3-Gens katalysiert einen Schlüsselschritt in diesem Prozess, daher selektiert 5-FOA hauptsächlich forura3-Mutanten mit Funktionsverlust. Canavanin ist ein toxisches Arginin-Analogon, dessen Aufnahme den Arginin-Transporter erfordert. Canavanine selektiert auf Funktionsverlustmutanten dieses Transporters, der vom CAN1gen kodiert wird. a-Faktor ist ein Peptidpheromon, das von Zellen des Paarungstyps (MATa) sezerniert wird. Bindung des Pheromons an den Ste2-Rezeptor an

aMATacell signalisiert über eine MAP-Kinase-Kaskade die Paarungsreaktionsgene und einen G1-Arrest (Dohlman

2002). Wildtyp-MATa-Zellen sezernieren eine Protease, Bar1, die einen Faktor abbaut. BAR1 verhindert das Wachstum auf einem Medium, das einen Faktor enthält, und ermöglicht es uns, die Resistenzrate gegen einen Faktor mithilfe des Fluktuationsassays zu messen. Es gibt mindestens 10 Gene, deren Funktionsverlust zu einer a-Faktor-Resistenz führt, daher erwarten wir, dass die Mutationsrate zur a-Faktor-Resistenz um eine Größenordnung höher ist als die Mutationsrate zu 5-FOA und Canavanin-Resistenz. Wir finden die phänotypischen Mutationsraten zu 5-FOA, Canavanin und einer Faktor-Resistenz bei 5,43 3 108, 1.52 3 107, und 3,07 3 106/ Genom/Generation bzw. Wenn wir unsere Schätzungen der phänotypischen Mutationsraten und der Locus-spezifischen effektiven Zielgrößen kombinieren, kommen wir zu dem Schluss, dass die Mutationsraten pro Basenpaar bei URA3 und CAN1 3,8031010 . betragenund 6.4431010/bp/generation, was darauf hindeutet, dass die Mutationsrate variiert über das Hefegenom.

Stämme und Medien: GIL104 ist ein haploider Hefestamm, abgeleitet vom W303-Hintergrund mit GenotypURA3,leu2,trp1, CAN1, ade2, his3, bar1DTADE2, MATa. Hefe wurde angebaut

synthetisches komplettes (SC) Medium (Shermanet al. 1974), SC

Medium ohne Uracil (SCUra) oder SC-Medium mit nur 1% Glucose (SCLG). Die Kulturen, aus denen sich die Fluktuationsassays zusammensetzten, wurden auf vier Arten von selektiven Medien ausplattiert: 13

Canavanin½SC-Medium ohne Arginin (SCArg), 60 mg/ Liter-Canavanin (Sigma-Aldrich, St. Louis) 103Canavanin

(SCArg, 0,6 g/Liter-Canavanin) 5-FOA½SCUra, 1 g/Liter

5-FOA (Sigma-Aldrich) unda-Faktor½Hefeextrakt, Pepton, Dextrose (YPD), 10mg/ml-Faktor (Bio-Synthese, Lewisville, TX). Zur Vorbereitung des Ausplattierens mehrerer Flecken mutierter Kulturen auf jeder Platte wurden die Platten übertrocknet, indem ein Whatman-Filterpapier (Sorte 3, 90 mm) unter Verwendung eines Replika-Plattierungsblocks auf die Platten gedrückt wurde und der Filter für at . an Ort und Stelle belassen wurde mindestens 30min. Die Filter entfernen 1 ml Flüssigkeit und die Platten können nach dem Entfernen der Filter mehrere Tage verwendet werden.

Fluktuationsassays: Fluktuationsassays wurden an 10 Klonen von GIL104 durchgeführt, um die Rate zu bestimmen, mit der Zellen mutierten, um resistent gegen 5-FOA, 103 Canavanin oder Ora-Faktor zu werden. Medien- und Kulturvolumina wurden so gewählt, dass für jeden Phänotyp eine ähnliche Anzahl von Mutanten gezählt wurde: 200 ml SC, 100 ml SC und 10 ml SCLG für Resistenz gegenüber 5-FOA, 103 Canavanin bzw. a-Faktor.

(sechs Spots pro Platte) 100-ml-Kulturen wurden auf acht 103-Canavanin-Platten gespottet (neun Spots pro Platte) und 10-ml-Kulturen wurden mit sterilem Wasser auf 100 ml gebracht und auf acht a-Faktor-Platten gespottet (neun Spots pro Platte) ). Ein Tecan Genesis Liquid Handler (Tecan U.S., Durham, NC) wurde verwendet, um die Punktplattierung halbautomatisch zu machen. Wir gehen davon aus, dass der Verlust mutierter Zellen aufgrund von Verdunstung, Flüssigkeitshandhabung und unvollständiger Plattierungseffizienz vernachlässigbar ist. Unter den verwendeten Bedingungen betrug die durchschnittliche Zellzahl pro Kultur 2.13107, 1.33107, und 3,8 3 105, für 5-FOA, 103 Canavanin und ein-Faktor, bzw.

Die Platten wurden über Nacht bei Raumtemperatur trocknen gelassen und dann bei 30° für 1, 2 oder 5 Tage inkubiert Fora-Faktor, 103

Canavanin bzw. 5-FOA, wonach die Anzahl der Mutanten pro Spot unter Verwendung eines Dissektionsmikroskops gezählt wurde. Für 103-Canavanin-Anda-Faktor-Platten verwendeten wir einen Größenschwellenwert: Kolonien, 1 mm bei 103-facher Vergrößerung für Canavanin oder 3 mm bei 63-facher Vergrößerung für Fora-Faktor, wurden vermutlich auf Mutationen zurückgeführt, die nach dem Ausplattieren der Zellen aufgetreten waren und wurden nicht gezählt. Die Wahl des Größen-Cutoffs basierte auf der Suche nach einem natürlichen Bruch in der Koloniegrößenverteilung. Da die Koloniegrößenverteilung jedoch nicht bimodal war, kann davon ausgegangen werden, dass einige Leaky-Mutanten ausgeschlossen wurden. Dies wird deutlich, wenn wir Jackpots von Mutanten beobachten, die kleiner als unsere Größenschwelle sind, die aus der Analyse ausgeschlossen wurden. Aus diesem Grund ist es wichtig, dass die Stämme, die wir zur Bestimmung der Zielgröße sequenziert haben, aus den Platten der Fluktuationsassays ausgewählt wurden, damit alle Leaky-Mutanten, die von der Bestimmung der Mutationsraten ausgeschlossen wurden, auch von der Berechnung von . ausgeschlossen wurden Zielgröße. Fluktuationstests auf Resistenz gegen 13canavanin wurden ähnlich denen für 103canavanin durchgeführt, außer 13

Canavanin-Platten wurden 3 Tage nach der Plattierung gezählt.

Analyse von Fluktuationsdaten: Fluktuationsdaten wurden mit der Ma-Sandri-Sarkar-Maximum-Likelihood-Methode analysiert, bei der die Daten auf der Grundlage eines einzigen Parameters, der erwarteten Mutationszahl, an ein Modell der Luria-Delbru¨ck-Verteilung angepasst werden Ereignisse pro Kultur (Sarkaret al.1992).

Die Mutationsrate wird aus der Gleichung m¼m/N berechnet, wobei Ni die durchschnittliche Zellzahl pro Kultur ist (ungefähr gleich der Zahl der Zellteilungen pro Kultur, da das anfängliche Inokulum viel kleiner als N ist). Fünfundneunzig Prozent Konfidenzintervalle wurden mit den Gleichungen 29 und 30 von Foster (2006) zugewiesen.

Die Daten wurden auch an ein Zwei-Parameter-Modell angepasst, das das Wachstum nach der Beschichtung berücksichtigt. Dieses Modell ist ein Luria–

Delbrück-Verteilung überlagert mit einer Poisson-Verteilung mit einer Rate Nmd¼md, wobei die mittlere Anzahl von Zellteilungen (in denen Mutanten auftreten und nachgewiesen werden konnten) in der Abstammungslinie von Zellen, die auf den selektiven Platten ausplattiert wurden, mit der Anzahl der Generationen von Wachstumsnachplattierung (g) byd¼ 2g 1. Die Wahrscheinlichkeitsverteilung für die Anzahl der Mutanten

pro Kultur im Zwei-Parameter-Modell ist somit die gemeinsame Verteilung der Luria-Delbru¨ck (Parameter m) und der Poisson (Parametern¼md) sie sind gleich unter der Annahme, dass die Mutationsrate für die Postplating-Zellteilungen gleich ist.

Wir haben zwei Tests verwendet, um zu beurteilen, ob das Ein- oder das Zwei-Parameter-Modell am besten zu den Daten passt. Beide stützten sich auf die Berechnung der Wahrscheinlichkeit, die beobachteten Daten anhand des Modells wiederzugewinnen. Diese Wahrscheinlichkeit,Pj, wobeijis die Anzahl der Parameter im Modell ist, wurde berechnet alsPj ¼Pmax

N i wobei pi die Wahrscheinlichkeit des Beobachtens von Imutanten und N die Anzahl unabhängiger Kulturen ist, die imitierte Kolonien produzieren. Der Log-Likelihood-Ratio-Test berechnet L¼2(log(P2)log(P1)),

die als x2 . verteilt ist-Verteilung mit 1 d.f. Akaikes Das Informationskriterium (AIC) berechnet den Parameter AIC¼ 2j2(log(Pj)) und stellt fest, dass die beste Anpassung diejenige mit dem niedrigsten AIC-Wert ist. Der Ftest ist für diese Vergleiche nicht geeignet, da er ein lineares Modell mit Fehlern annimmt, die aus der gleichen Normalverteilung an jedem Datenpunkt gezogen werden, beide Annahmen, die durch die Daten aus Fluktuationstests verletzt werden.

Sequenzierung von ura3- und can1-Mutanten: Tabelle 1 listet die Primer auf, die verwendet wurden, um theura3- und can1-Allele von 5-FOA bzw. 103 Canavanin-resistenten Kolonien zu amplifizieren und zu sequenzieren. Vor der Isolierung der genomischen DNA wurden 5-FOA- und 103-Canavanin-resistente Kolonien erneut auf selektivem Medium ausgestrichen.

Computeranalyse: Die Ma-Sandri-Sarkar-Maximum-Likelihood-Analyse und die Zwei-Parameter-Anpassung wurden in Matlab (MathWorks, Natick, MA) durchgeführt. Die Anpassung an das Zwei-Parameter-Modell wurde durch Optimieren von m (withd fixed), Optimieren (withmfixed) und Wiederholen dieses Prozesses bis zur Konvergenz erreicht. AIC wurde verwendet, um zu bestimmen, welches Modell am besten zu den Daten passt (Akaike1974). Matlab war es auch gewohnt

Simulieren Sie Fluktuationsdaten, berechnen Sie die Quadratsummendifferenzen zwischen Luria-Delbrück-Verteilungen und -Daten und erstellen Sie Bootstrap-Schätzungen der effektiven Zielgrößen, um 95%-Konfidenzintervalle zu generieren. Matlab-Dateien für die meisten dieser Operationen sind unter http://murraylab.mcb.harvard.edu/fluctuation/ programmes.htm verfügbar.

In dieser Studie verwendete Primer

Primername Sequenz Zweck

URA3extF 59ATCAAAGAAGGTTAATGTGG 39 PCR

URA3extR 59TCATTATAGAAATCATTACG 39 PCR/Sequenzierung

URA3extF3 59TTGATTCGGTAATCTCCGAG 39 Sequenzierung

URA3intF2 59TGGGCAGACATTACGAATGC 39 Sequenzierung

URA3intR2 59CAAACCGCTAACAATACCTG 39 Sequenzierung

CAN1extF2 59TCTTCAGACTTCTTAACTCC 39 PCR

CAN1extR2 59ATAGTAAGCTCATTGATCCC 39 PCR/Sequenzierung

CAN1ext/intF1 59AAAAAAGGCATAGCAATGAC 39 Sequenzierung

CAN1intF2 59GACGTACAAAGTTCCACTGG 39 Sequenzierung

CAN1intF3 59TCAAAGAACAAGTTGGCTCC 39 Sequenzierung

CAN1intR2 59TAGATGTCTCCATGTAAGCC 39 Sequenzierung

Fluktuationsassays und phänotypische Mutationsraten:

Die Genauigkeit der Mutationsratenschätzungen aus Fluktuationsassays hängt davon ab, wie das Experiment durchgeführt und die Daten analysiert werden. Wir haben beides verbessert und betrachten jedes nacheinander.

Durchführung von Fluktuationsassays: Eine Möglichkeit, die Genauigkeit von Mutationsratenschätzungen aus Fluktuationsassays zu erhöhen, besteht darin, die Anzahl der Kulturen zu erhöhen (Stewart 1994). Normalerweise werden Fluktuationsassays in Reagenzgläsern durchgeführt, um den Durchsatz zu erhöhen, führen wir die Assays jedoch in 96-Well-Platten durch. Wir plattieren 72 der Kulturen auf selektivem Medium, um die Anzahl der Mutanten pro Kultur zu bestimmen, die restlichen 24 werden verwendet, um die durchschnittliche Anzahl von Zellen pro Kultur zu bestimmen (siehe Materialien und Methoden). Mit dem 96-Well-Format können wir variieren

das Kulturvolumen von 10 bis 200 ml und kann Mutationsraten über zwei Größenordnungen messen (Tabelle 2). Anstatt Kulturen auf selektives Medium zu verteilen, beschmutzen wir Kulturen auf übertrockneten Platten, wo sie sich gleichmäßig über eine Fläche von 1,3–3 cm2 . verteilen, abhängig auf dem Volumen gesichtet. Dies erhöht die Effizienz und reduziert die Anzahl der Platten, da bis zu neun Kulturen auf eine Platte gespottet werden können.

Die Kombination aus Spot-Plating und dem 96-Well-Format ermöglicht die Automatisierung des Fluktuationsassays. Um dies zu demonstrieren, haben wir den Prozess mit einem Liquid-Handler halbautomatisiert, wodurch wir alle hier beschriebenen Fluktuationsassays – das Äquivalent von drei 720-Röhrchen-Fluktuationsassays – parallel durchführen konnten.

Analysieren von Fluktuationsdaten und Postplating-Wachstum auf 13

Canavanin: Es gibt viele Methoden zur Berechnung von Mutationsraten aus Fluktuationsdaten (Foster 2006), von denen die Ma-Sandri-Sarkar Maximum-Likelihood-Methode bevorzugt wird, weil sie die genaueste ist

gültig für jeden Bereich der erwarteten Anzahl von Mutationsereignissen pro Kultur (m), und 95%-Konfidenzintervalle können durch ein empirisch ermitteltes Gleichungssystem berechnet werden (Stewart1994 Roscheand Foster2000). Damit die mit dieser Methode generierten Schätzungen der Mutationsraten und 95 %-Konfidenzintervalle genau sind, müssen sich die Daten der Luria-Delbru¨ck-Verteilung annähern. Wir haben diese Näherung getestet, indem wir die Ma-Sandri-Sarkar-Maximum-Likelihood-Methode verwendet haben, um die vorhergesagte kumulative Häufigkeitsverteilung von Mutanten gegen die experimentellen Daten abzuschätzen und dann aufzuzeichnen. Fluktuationsassays auf 5-FOA ergaben eine enge Übereinstimmung zwischen vorhergesagten und beobachteten Verteilungen (Abbildung 1). Im Gegensatz dazu lieferten Assays mit 13 Canavanin und a-Faktor Daten, die signifikant von der Luria-Delbrück-Verteilung abweichen. Im Vergleich zur erwarteten Verteilung sind im 13canavanin-Experiment Kulturen mit wenigen Mutanten unterrepräsentiert und Kulturen mit vielen Mutanten überrepräsentiert (Abbildung 1, Ein-Parameter-Modell). Diese Abweichung kann als Kombination einer Luria-Delbru¨ck-Verteilung und einer Poisson-Verteilung erklärt werden.

Eine mögliche Erklärung ist, dass sich Canavanin-sensitive Zellen teilen und Canavanin-resistente Mutationen hervorrufen können, nachdem sie ausplattiert wurden, die Anzahl der zusätzlichen Mutantenkolonien wird der Poisson-Verteilung folgen. Wir passten die Verteilung der Mutantenfrequenzen an ein Zwei-Parameter-Modell an, das Postplating-Wachstum und Mutation beinhaltet. Dieses Modell ist die gemeinsame Verteilung einer Luria-Delbru¨ck-Verteilung (mit Parameterm) und einer Poisson-Verteilung (mit param-etern¼md). Die Daten von 13canavanin passten besser zum Zweiparametermodell (Abbildung 1).

Wir quantifizierten die Verbesserung der Passform durch zwei Methoden. Die erste besteht darin, die beste logarithmische Wahrscheinlichkeit zu vergleichen

Phänotypische Mutationsraten

Mutationsrate (Mutationen/Genom/Generation)

A 5,51 (4,31–6,82) 2,08 (1,67–2,51) 6,49 (4,89–8,24)

B 5,51 (4,31–6,81) 1,81 (1,44–2,20) 4,77 (3,53–6,15)

C 6,28 (4,96–7,70) 2,21 (1,77–2,69) 7,19 (5,49–9,07)

D 6,58 (5,23–8,04) 1,88 (1,51–2,29) 5,08 (3,73–6,58)

E 5,60 (4,40–6,90) 2,06 (1,66–2,50) 4,48 (3,25–5,85)

F 6,07 (4,81–7,44) 1,87 (1,49–2,28) 6,70 (5,10–8,45)

G 5,35 (4,21–6,59) 1,76 (1,41–2,14) 4,74 (3,50–6,12)

H 6,05 (4,79–7,42) 2,05 (1,65–2,49) 5,01 (3,69–6,47)

I 6,00 (4,76–7,36) 1,79 (1,43–2,17) 7,03 (5,33–8,90)

J 5,50 (4,35–6,76) 2,09 (1,67–2,55) 3,05 (2,1–4,11)

Durchschnitt6SD 5.8560.41 1.9660.16 5.4561.34

Kombiniert 5,86 (5,46–6,28) 1,95 (1,83–2,08) 5,43 (4,97–5,91)

Mutationsraten Toa-Faktor-Resistenz, Canavanin-Resistenz (CanR) und 5-Fluororotsäureresistenz (5-FOAR) für 10 Klone von GIL104. Klammern geben die 95 %-Konfidenzintervalle an, die mit Gleichungen berechnet wurden 29 und 30 von Foster(2006). Der kombinierte Datensatz behandelt die 10 72-Röhrchen-Fluktuationsassays als ein 720-Röhrchen

berechnet unter Ein- und Zweiparametermodellen. Solange eine große Anzahl von Kulturen verwendet wird, wird die doppelte Differenz zwischen den besten Ein- und Zweiparameter-Scores½L¼2(log(P2 Param)log(P1 Param) verteilt

asx2mit 1 d.f. Dies bedeutet, dass, wenn der beste Zwei-Parameter Punktzahl ist 0,1,92 log-Einheiten besser als die beste Ein-Parameter-Punktzahl, die Wahrscheinlichkeit beträgt 0,95, dass das Zwei-Parameter-Modell besser an die Daten angepasst ist. Die zweite Methode bestand darin, den AIC zu verwenden, der sowohl die logarithmische Wahrscheinlichkeit als auch die Anzahl der Parameter bei der Berechnung eines Scores verwendet, um das Modell zu finden, das am besten zu den Daten passt. Beide werden in Materialien und Methoden näher beschrieben.

Für Fluktuationsassays auf 13canavanin zeigen sowohl der Log-Likelihood-Ratio-Test als auch der AIC an, dass die Daten am besten durch das Zwei-Parameter-Modell angepasst werden. Bei Fluktuationsassays auf 5-FOA gibt es keine Verbesserung der Anpassung unter Verwendung des Zwei-Parameter-Modells. Um die Postplating-Mutation zu minimieren, erhöhten wir die Canavanin-Konzentration um das 10-fache und zählten die Platten 1 Tag früher. Die Daten von 103 Canavanin nähern sich der Luria-Delbru¨ck-Verteilung eher an (Abbildung 1). Obwohl das Zwei-Parameter-Modell immer noch eine etwas bessere Anpassung liefert, werden die Daten sowohl nach dem Log-Likelihood-Ratio-Test als auch nach dem AIC am besten durch das Ein-Parameter-Modell angepasst. Für den Ona-Faktor des Fluktuationsassays werden die Daten am besten durch das Zwei-Parameter-Modell angepasst, jedoch erfassen beide Modelle nicht alle Merkmale dieser Verteilung (Abbildung 1). Phänotypische Mutationsraten: Es wurden Fluktuationsassays durchgeführt, um die Mutationsraten zu a-Faktor, 103 . zu bestimmen

Canavanin und 5-FOA-Resistenz für 10 isogene Klone eines Stamms aus dem W303-Hintergrund (GIL104) wurden die Daten unter Verwendung des Einparameter- und des Zweiparameter-Modells analysiert (Tabellen 2 bzw. 3). Für jeden Assay wurden der Log-Likelihood-Ratio-Test und der AIC angewendet, um zu bestimmen, welches Modell am besten zu den Daten passte

(Tisch 3). Alle Fluktuationsassays für a-Faktor werden am besten durch das Zwei-Parameter-Modell beschrieben, während alle Fluktuationsassays für 5-FOA am besten durch die Luria-Delbru¨ck-Verteilung (das Ein-Parameter-Modell) beschrieben werden. Für 103 Canavanin werden fünf Fluktuationsassays nach dem Log-Likelihood-Ratio-Test oder sechs nach dem AIC durch das Zwei-Parameter-Modell am besten angepasst.

Unter Verwendung der kombinierten Daten der 10 Klone (effektiv ein Fluktuationsassay mit 720 Parallelkulturen) und des Zweiparametermodells bestimmen wir die phänotypischen Mutationsraten von Toa-Faktor, 103Canavanin und 5-FOA-Resistenz zu 3.073 106, 1.52 3 107, und 5,43 3 108, bzw. Für die 5-FOA-Resistenz sind die Daten am besten beschrieben durch das Ein-Parameter-Modell (d¼0 für das Zwei-Parameter-Modell, was bedeutet, dass kein Wachstum und keine Mutation nach der Ausplattierung auftreten), daher können wir die Gleichungen 29 und 30 von Foster (2006) verwenden, um unserer Schätzung ein 95%-Konfidenzintervall zuzuordnen der Mutationsrate. Daraus ergibt sich ein Konfidenzintervall von 4,97–5.913108pro Generation (Tabelle 2). Für das Zweiparametermodell haben wir Konfidenzintervalle durch Simulation bestimmt. Für jeden kombinierten 720-Kulturen-Fluktuationstest haben wir die wahrscheinlichsten Werte anhand der Daten ermittelt. Um die erwartete Variation dieser Parameter abzuschätzen, haben wir 1000 Fluktuationsassays simuliert, indem wir die kombinierte Luria-Delbru¨ck/Poisson-Verteilung unter Verwendung der aus den Daten bestimmten Parameter entnommen haben. Wir nehmen die 95 %-Konfidenzintervalle für unsere Schätzung von m als Werte von m an, die 95 % der simulierten Experimente umfassen. Daraus berechnen wir die 95%-Konfidenzintervalle des Zweiparametermodells zu 2,65–3,623 106, 1.34– 1.71 3 107, und 4,78–5,87 3 108 zum ein-Faktor, 103 Canavanin- bzw. 5-FOA-Resistenz.

Mutationsspektren und Zielgröße: Mutationsspektren: Wir wollten unsere phänotypischen Mutationsraten in Abbildung 1 umwandeln. – Ergebnisse aus drei 72-Röhrchen

Fluktuationsassays unter Verwendung von GIL104-Klon A, plattiert auf 13canavanin, 5-FOA, 103

Canavanin und a-Faktor. Durchgezogene Kreise zeigen die kumulative Verteilung der Daten. Durchgezogene Kurven zeigen die kumulativen Luria-Delbru¨ck-Verteilungen (Ein-Parameter-Modell) an die Daten mit den Parametern m¼4,80, 1,31, 2,82 und 1,97 für 13 Can-Avanin, 5-FOA, 103 Canavanin und a-Faktor , bzw. Die dick schattierte Kurve ist das Zwei-Parameter-Modell des Wachstums nach der Beschichtung mit m ¼ 2,31, d ¼ 2,62 m ¼ 2,39, d ¼ 0,37 und m ¼ 1,10 und d ¼ 1,42 für 13 Canavanin bzw. 103 Canavanin. Die Einparameter- und Zwei-Ein-Parameter-Modelle sind für 5-FOA gleich. Unter Verwendung des Informationskriteriums von Akaike (Akaike 1974)

Mutationsraten pro Basenpaar. Das Material für diese Konvertierung sind die Mutationsspektren aus den Fluktuationsassays, die wir 237ura3Allele und 227can1Allele von 5-FOA- bzw. 103 Canavanin-resistenten Stämmen sequenziert haben (die Identität aller 464 mutierten Allele ist im Supplemental Informationen unter http://www.genetik.org/supplemental/). Dreißig 5-FOA-resistente Mutanten enthalten Wildtyp-URA3-Allele 29 dieser Mutanten sind Uracil-Prototrophe. Es wurde berichtet, dass Mutationen in FUR1 diesen Phänotyp verleihen können, jedoch konnten wir keine Mutationen innerhalb der kodierenden Sequenz dieses Gens für eines der 29 5-FOA-resistenten Uracil-Prototrophe finden (Daten nicht gezeigt). Keine der 207 ura3-Mutanten ist prototroph und jede enthält eine einzelne Mutation oder zwei Mutationen innerhalb weniger Nukleotiden. Es gibt 167-bp-Substitutionen (64 Nonsense und 103 Missense), 22 Einzel-bp-Deletionen, 3 2-bp-Deletionen, 3 Einzel-bp-Insertionen, eine 3-bp-Insertion, zwei große Tandem-Duplikationen und neun Doppelmutationen (Abbildung 2). Alle 227 103 Canavanin-resistenten Mutanten enthalten eine einzelne Mutation oder eng benachbarte Mutationen am CAN1-Locus. Wir finden 150 bp-Substitutionen (70 Nonsense und 80 Missense), 55 Single-bp-Deletionen, 8 Single-bp-Insertionen, eine 2-bp-Insertion, 10 Doppelmutationen und 3 komplexe Mutationen, darunter ein acan1-Allel mit einer 27-bp-Deletion und eine 30-bp-Tandem-Duplikation (Abbildung 3).

Nonsense-Mutationen pro Basenpaar: Aus den bisherigen Ergebnissen können wir die Mutationsrate pro Basenpaar zu Nonsense-Mutationen an den CAN1- und URA3-Genen berechnen. Zuerst müssen wir die phänotypische Mutationsrate auf 5-FOA-Resistenz korrigieren, um zu berücksichtigen, dass nur 207 von

237 5-FOA-Mutanten sindURA3-Mutanten. Daraus ergibt sich eine Mutationsrate für Funktionsverlust von 4,753108zum URA3 und 1.523 107zumCAN1. Wenn wir diese multiplizieren Raten durch den Anteil der Nonsense-Mutationen in den Mutationsspektren finden wir, dass die Raten der Nonsense-Mutationen bei URA3 und CAN1 1,473108 . sindund 4,693 108, bzw. ZumURA3undCAN1, wir haben die gezählt Anzahl möglicher Nonsense-Substitutionen aus den bekannten Sequenzen dieser Gene. URA3 ist 804 bp groß, daher gibt es 2412 mögliche Substitutionen (804 bp33 mögliche Substitutionen pro Basenpaar). Davon führen 123 zu Nonsense-Mutationen. Durch Teilen dieser Raten durch die Anzahl möglicher Nonsense-Substitutionen und Multiplikation mit 3, da es 3 mögliche Mutationen an jeder Base gibt, finden wir, dass die pro Basenpaar normalisierte Nonsense-Mutationsrate 3,5831010 . beträgtzumURA3und 6.213 1010zumCAN1. Wiederholen der obigen Analyse für alle 10 Fluktuationsassays an CAN1 und URA3 aus Tabelle 3 finden wir, dass sich die Nonsense-Mutationsraten pro Basenpaar an diesen beiden Loci signifikant unterscheiden (Wilcoxon-Rangsumme, P , 1.833 104). Diese Berechnungen wurden durchgeführt mit Mutationsraten aus dem Zwei-Parameter-Modell, korrigiert für Postplating-Wachstum und Mutation auf Cana-Vanine-Platten. Hätten wir das Ein-Parameter-Modell verwendet, wäre der Unterschied in den Mutationsraten zwischen URA3 und CAN1 größer gewesen, da das Ein-Parameter-Modell die phänotypischen Mutationsraten zur Canavanin-Resistenz überschätzt.

Definition der effektiven Zielgröße:Wir definieren eine Zielgröße, um zwei Berechnungen durchzuführen: Bestimmung der genomischen Mutationsrate bei Experimenten, die die Mutationsrate an einem bestimmten Locus messen und Vorhersage der Rate


1. EINLEITUNG

Das Verständnis der genetischen Grundlagen von Prozessen wie Anpassung und Artbildung ist ein wichtiges Ziel der Evolutionsbiologie. Dies erfordert die Quantifizierung der Anzahl der beteiligten Loci und ihrer Verteilung im Genom (z. B. genomische Architektur) sowie der Art der Mutation und der damit verbundenen statistischen Eigenschaften. In letzter Zeit gab es einen Schwerpunkt auf Mutationstypen (z. B. SNPs, Translokationen, Inversionen) und detaillierte Diskussionen über die evolutionäre Bedeutung verschiedener Mutationstypen in der Literatur (z. B. Choi & Lee, 2020 Faria et al., 2019 Katju & Bergthorsson, 2013). Die meisten dieser Übersichtsarbeiten sowie die meisten theoretischen und empirischen Studien untersuchen jedoch nicht das gesamte Spektrum der Mutationstypen. Um die relative evolutionäre Bedeutung verschiedener Mutationstypen zu verstehen, müssen wir sie gleichzeitig in einem integrierten Rahmen betrachten.

Aus evolutionärer Sicht sind die wichtigsten Merkmale einer Mutation ihre Häufigkeit, ihre genetischen Auswirkungen auf die Population und wie diese die nachfolgenden evolutionären Ergebnisse beeinflussen können. Hier schlagen wir einen Forschungsrahmen vor, der Jahrzehnte der populationsgenetischen Forschung (Charlesworth & Charlesworth, 2010 Futuyma, 1986) nutzt, um die populationsgenetischen Effekte verschiedener Mutationstypen direkt zu nutzen, um ihre relative evolutionäre Bedeutung zu bestimmen (Abbildung 1a). Unter populationsgenetischen Effekten verstehen wir den Einfluss einer Mutation auf die populationsgenetischen Parameter: Rekombinationsrate, effektive Populationsgröße, Selektions- und Dominanzkoeffizienten (siehe Abbildung 1c für einen Überblick über die populationsgenetischen Effekte jedes Mutationstyps). Obwohl auch andere Merkmale, etwa ob eine Mutation regulatorische oder kodierende Regionen betrifft, für die Evolution wichtig sind (Hoekstra & Coyne, 2007 ), konzentrieren wir uns hier auf Merkmale, die direkt mit dem Mutationstyp in Verbindung gebracht werden können.

Unser Framework kombiniert das, was wir als „Forward“- und „Reverse“-Ansatz bezeichnen. Ausgehend von der Mutation charakterisiert der Vorwärtsansatz, wie oft verschiedene Arten von Mutationen auftreten (Abbildung 1b) und ihre populationsgenetischen Auswirkungen (Abbildung 1c), um ihre Rolle bei verschiedenen evolutionären Ergebnissen vorherzusagen. Der umgekehrte Ansatz beginnt mit dem evolutionären Ergebnis und bestimmt anhand empirischer Daten systematisch die relativen Beiträge mehrerer Mutationstypen. Es gibt bereits eine Fülle von Erkenntnissen über die populationsgenetischen Auswirkungen verschiedener Mutationen (z. B. der Vorwärtsansatz Dobigny et al., 2017 Elena et al., 1998 Korunes & Noor, 2019 Malik, 2009). Im Gegensatz dazu untersuchen nur wenige Studien mehrere Arten von Mutationen gleichzeitig mit dem umgekehrten Ansatz. Daher konzentrieren wir uns hier auf den Vorwärtsansatz.

Um den Vorwärtsansatz zu skizzieren, geben wir eine nicht erschöpfende Zusammenfassung dessen, was über die Mutationsraten und die populationsgenetischen Auswirkungen der verschiedenen Mutationen bekannt ist, und nutzen dabei die umfangreiche vorhandene Arbeit (Choi & Lee, 2020 Faria et al., 2019 Katju & Bergthorsson, 2013). Wir betonen, dass die Quantifizierung dieser Effekte, die Bewertung der Unterschiede zwischen den Mutationstypen und die Bestimmung der Verteilung der Effektstärken ein entscheidender Schritt nach vorne sein werden und schlagen verschiedene Möglichkeiten vor, wie dies erreicht werden kann. Wir diskutieren Bereiche, in denen mehr empirische Daten, Theorie und Synthese für den Vorwärtsansatz benötigt werden, und heben die Bedeutung der Anwendung des Rückwärtsansatzes hervor.

1.1 Mutationsrate

Die Mutationsrate ist ein kritischer Parameter bei der Untersuchung der evolutionären Auswirkungen verschiedener Mutationstypen. Sie kann direkt gemessen werden, indem man die Anzahl der Mutationen in Gameten, Zygoten oder Nachkommen vergleicht (Fu & Huai, 2003). Für SNPs kann sie auch indirekt gemessen werden, indem synonyme (normalerweise als neutral angenommene) Polymorphismusdaten innerhalb und zwischen eng verwandten Arten verglichen werden. Schätzungen der Mutationsrate variieren stark zwischen Taxa und Mutationstypen (Abbildung 1b). Unterschiedliche Mutationen variieren jedoch hinsichtlich ihrer Nachweisbarkeit (beispielsweise werden SNPs mit Short-Read-Sequenzierungsdaten viel wahrscheinlicher nachgewiesen als größere Insertionen oder Deletionen [Ho et al., 2020]), was zu einer Unterschätzung von . führen kann die Mutationsrate verschiedener Mutationen. Neue Methoden können helfen, dieses Problem zu beheben. Insbesondere können Long-Read-Daten in Kombination mit anderen Methoden wie Linked Read Sequencing (Seo et al., 2016) und Chromatin-Capture- und -Sequenzierungstechniken wie Hi-C (Wang et al., 2020) die Identifizierung großer Strukturvarianten erleichtern (Weihnachten et al., 2019). Daher sind zwei wichtige Schritte, die von unserem Rahmen identifiziert werden, (i) die Weiterentwicklung neuer Methoden, die den gleichzeitigen Nachweis der verschiedenen Mutationstypen ermöglichen, und (ii) die Erhöhung sowohl der Anzahl als auch der taxonomischen Breite von Studien, die Mutationsraten direkt abschätzen, und Analysieren Sie mehrere verschiedene Mutationstypen innerhalb desselben Taxons.


Was ist der Unterschied zwischen Mutation pro Basenpaar und Mutation pro Genom? - Biologie

Die Ähnlichkeiten und Unterschiede zwischen Menschen zu verstehen, beschäftigt Psychologen, Anthropologen, Künstler, Ärzte und natürlich viele Biologen. Selbst wenn man sich nur auf die genetischen Unterschiede zwischen den Menschen einlässt, gibt es eine schillernde Bandbreite an Themen zu diskutieren. Der Tag, an dem DNA, die an einem Tatort extrahiert wurde, zu einem Fahndungsfoto-Porträt führen kann, scheint bereits gekommen zu sein, zumindest laut einer kürzlich erschienenen Veröffentlichung über die Modellierung von 3D-Gesichtsformen aus DNA (P. Claes et al, PLOS Genetics, 10:e1004224, 2014). Können wir im Sinne der Zellbiologie durch die Zahlen eine grundlegende Intuition gewinnen, wenn wir die Implikationen einiger weniger Schlüsselzahlen logisch analysieren, die sich auf die Frage der genetischen Vielfalt beim Menschen beziehen?

Wir beginnen damit, uns auf die Unterschiede einzelner Basenpaare oder Polymorphismen (SNPs) zu konzentrieren. Andere Variationskomponenten wie Insertionen und Deletionen, unterschiedliche Anzahl von Genwiederholungen (ein Teil der sogenannten Kopienzahlvariationen oder CNVs) und transponierbare Elemente werden im Folgenden berührt. Wie viele einzelne Basenpaarvariationen würden Sie zwischen Ihnen und einer zufällig ausgewählten Person an einer Straßenecke erwarten? Sequenzierungsbemühungen wie das 1000-Genome-Projekt geben uns eine Faustregel. Sie finden etwa ein SNP pro 1000 Basen. Das heißt, andere Komponenten beiseite gelegt, die Grundlage für die Behauptung, dass Menschen zu 99,9% genetisch ähnlich sind. Aber diese genetische Ähnlichkeit wirft die Frage auf: Wie kommt es, dass wir uns so anders fühlen als die Person, der wir auf der Straße begegnen? Nun, lesen Sie weiter, um mehr über andere genetische Unterschiede zu erfahren, aber man sollte auch verstehen, wie unser Gehirn darauf eingestellt ist, Unterschiede zu bemerken und zu verstärken und die verbindenden Eigenschaften zu verteilen, wie zum Beispiel, dass wir alle zwei Hände, eine Nase, ein großes Gehirn und so weiter haben . Für einen Außerirdischen würden wir wahrscheinlich alle gleich aussehen, genau wie Sie vielleicht zwei Mäuse sehen, und wenn ihr Pelzmantel gleich ist, würden sie wie Klone erscheinen, selbst wenn einer der Richard Feynman seines Clans und der andere der Winston Churchill ist.

Zurück zu den Zahlen. Lassen Sie uns die Genauigkeit und die Auswirkungen der Faustregel von einem SNP pro 1000 Basen überprüfen. Das menschliche Genom ist etwa 3 Gbp lang. Dies deutet auf etwa 3 Millionen SNPs bei zwei zufälligen Personen hin. Dies ist in der Tat der gemeldete Wert mit einer Genauigkeit von bis zu 10 %, was keine Überraschung ist, da dies der Ursprung der Faustregel (BNID 110117) ist.Was können wir noch zu dieser Nummer sagen? Mit etwa 20.000 Genen, die jeweils eine Kodierungssequenz (Exons) von etwa 1,5 kb Länge aufweisen (d. h. etwa 500 Aminosäuren langes Protein im Durchschnitt), deckt die menschliche Kodierungssequenz 30 Mbp oder etwa 1 Prozent des Genoms ab. Wenn SNPs zufällig entlang des Genoms verteilt wären, würde dies auf etwa 30.000 SNPs über die Genomcodierungssequenz oder etwas mehr als 1 pro Gencodierungssequenz schließen lassen. Der gemessene Wert liegt bei etwa 20.000 SNPs, was ein Gefühl dafür gibt, wie falsch wir mit unserer Annahme lagen, dass die SNPs zufällig verteilt sind. Wir liegen also statistisch falsch, da jeder statistische Test eine beeindruckend geringe Wahrscheinlichkeit für das zufällige Auftreten dieses niedrigeren Wertes ergeben würde. Dies ist wahrscheinlich ein Hinweis auf eine stärker reinigende Selektion auf kodierende Regionen. Gleichzeitig deutet diese weniger als 2-fache Variation für unsere praktischen Begriffe darauf hin, dass dieser Bias nicht sehr stark ist und dass 1 SNP pro Gen eine vernünftige Faustregel ist.

Wie führt diese Verteilung von SNPs zu Veränderungen der Aminosäuren in Proteinen? Nehmen wir wieder eine homogene Verteilung zwischen Aminosäure-ändernden Mutationen (nicht synonym) und solchen, die die Aminosäureidentität nicht beeinflussen (synonym), an. Aus dem genetischen Code sollte die Zahl der nicht-synonymen Veränderungen, wenn keine Selektion oder Verzerrung jeglicher Art vorliegt, etwa viermal höher sein als die von synonymen Mutationen (d. h. synonyme Mutationen machen etwa 20 % der möglichen Mutationen aus, BNID 111167). Das liegt daran, dass es mehr Basensubstitutionen gibt, die eine Aminosäure verändern, als solche, die die Aminosäureidentität beibehalten. Was findet man in der Realität? Ungefähr 10.000 Mutationen jedes Typs werden tatsächlich gefunden (BNID 110117), was zeigt, dass es tatsächlich eine Tendenz zur Unterrepräsentation von nicht-synonymen Mutationen gibt, aber in unserer Weltsicht der Größenordnung ist dies keine große.

Eine Mutationsart, die jedoch besonders wichtig sein kann, ist die Nonsense-Mutation, die ein Stop-Codon erzeugt, das die Translation vorzeitig beendet. Wie oft könnten wir angesichts der Gesamtmenge von SNPs naiv erwarten, solche Mutationen zu finden? Drei der 64 Codons sind Stop-Codons, so dass wir grob 20.000*3/64 ≈ 1000 frühe Stop-Mutationen erwarten würden. Beobachtungen zeigen etwa 100 solcher Nonsense-Mutationen, was auf einen starken selektiven Bias gegen solche Mutationen hinweist. Dennoch finden wir es interessant, die Person neben uns zu betrachten und darüber nachzudenken, welche 100 Proteine ​​​​in unseren Genomen unterschiedlich verkürzt sind. Dank der diploiden Natur unserer Genome gibt es in der Regel eine weitere vollständig intakte Kopie des Gens (die Situation wird als Heterozygotie bezeichnet), die als Backup dienen kann.

Wie unterschiedlich ist Ihr Genotyp von jedem Ihrer Eltern? Angenommen, sie haben nicht verwandte Genotypen, sollten die obigen Werte halbiert werden, wenn Sie die Hälfte Ihres Vater- und Muttergenoms teilen. Also noch einige verkürzte Gene und substituierte Aminosäuren. Die Situation mit Ihrem Bruder oder Ihrer Schwester ist quantitativ ähnlich, da Sie wieder im Durchschnitt die Hälfte Ihres Genoms teilen (vorausgesetzt, Sie sind keine eineiigen Zwillinge…). Tatsächlich sind Sie und Ihre Geschwister für etwa 1/4 Ihres Genoms wie eineiige Zwillinge, d.h. Sie haben die gleichen zwei elterlichen Kopien der DNA. Insertionen und Deletionen (Spitzname Indels) von bis zu etwa 100 Basen sind schwieriger aufzuzählen, aber es wird eine Größenordnung von 1 Million pro Genom beobachtet, davon etwa 3000 in kodierenden Regionen (also eine Unterrepräsentation von etwa einer halben Größenordnung). Größere Variationen längerer Abschnitte, einschließlich Variationen der Kopienzahl, liegen im Bereich von Zehntausenden pro Genom, aber da es sich um so lange Abschnitte handelt, könnte ihre summierte Länge länger sein als die Anzahl der Basen in SNPs.

Die Fähigkeit, diese Variationen umfassend zu charakterisieren, ist eine sehr junge wissenschaftliche Errungenschaft, die erst im dritten Jahrtausend mit dem denkwürdigen Wettlauf zwischen den Konsortien des Humangenomprojekts und der Gruppe um Craig Venter begann. Beim Vergleich der Ergebnisse zwischen diesen beiden Teams stellt man fest, dass beim Vergleich des Genoms von Craig Venter mit dem der Konsensus-Referenzsequenz des menschlichen Genoms ein Unterschied von etwa 1,2% bei Berücksichtigung von Indels und CNVs und 0,1% bei Berücksichtigung von SNPs besteht: ≈ 0,3 %, wenn Inversionen berücksichtigt werden – insgesamt 1,6 % (BNID 110248). In dem Jahrzehnt, das der Sequenzierung des menschlichen Genoms folgte, entwickelten sich die Technologien extrem schnell weiter, was zum 1000-Genome-Projekt führte, das einigen unserer Leser, wenn sie diese Worte lesen, wie ein Rotationsprojekt erscheinen mag. Wer weiß, wie schnell der Leser tatsächlich unsere zitierten Zahlen überprüfen könnte, indem er sein Genom aus seinem medizinischen Bericht lädt und es mit einem zufälligen Freund vergleicht.


Abschluss

Die Mutationszüchtung ist seit langem ein nützliches Werkzeug nicht nur in der Werkzeugkiste von Pflanzenzüchtern, sondern auch in der Grundlagenforschung. Bei Nutzpflanzen, bei denen die Diversität für ein bestimmtes Merkmal gering oder nicht vorhanden ist, bietet die induzierte Mutagenese eine Möglichkeit. Mit einem klaren Ziel, einem effizienten mutagenen Protokoll und einem hohen Durchsatz und einer effizienten phänotypischen Screening-Methode kann die Mutagenese von großem Nutzen für die Verbesserung von Kulturpflanzen sein.


Was ist der Unterschied zwischen Mutation pro Basenpaar und Mutation pro Genom? - Biologie

Mitochondrien sind "Organellen" in lebenden Zellen, die für die Herstellung der Energiewährung ATP (Adenosintriphosphat) verantwortlich sind, die alle Zellen zum Funktionieren benötigen. Mitochondrien tragen ihre eigene separate DNA (mtDNA), die unabhängig von der Kern-DNA derselben Zelle ist. Die menschliche mtDNA besteht aus 37 Genen mit insgesamt etwa 16.000 Basenpaaren. Diese mtDNA mutiert auch viel schneller als die nukleäre DNA (nucDNA). Humane mtDNA wurde vollständig kartiert und alle kodierenden Regionen sind bekannt (sowie die Proteine ​​oder RNA, für die sie kodieren). Einige der mtDNA kodiert nichts (die diese Abschnitte immun gegen den "natürlichen Selektionsdruck" machen sollen) und sind als die "Kontrollregionen" bekannt. Eine bestimmte Region scheint schneller zu mutieren als jede andere Region (1,8-mal schneller), da die Unterschiede zwischen den Menschen hier am größten sind. 4 Bei der Zellteilung nimmt jede Zelle einen Teil der Mitochondrien mit. Die Mitochondrien replizieren sich selbstständig innerhalb der Zelle. Darüber hinaus wird allgemein angenommen, dass Mitochondrien immer von der Mutter an die Nachkommen vererbt werden, ohne an der genetischen Vermischung und Rekombination der mtDNA mit der mtDNA des Vaters beteiligt zu sein. In letzter Zeit wurde diese Vorstellung jedoch in Frage gestellt. Wie sich herausstellte, wurden viele Fälle von väterlich gewonnener mtDNA in modernen Familien von Menschen sowie anderen Arten nachgewiesen. Betrachten Sie die Ergebnisse einer interessanten Studie, die von Schwartz und Vissing in der Ausgabe 2002 des veröffentlicht wurde New England Journal of Medicine:

„Man nimmt an, dass die mitochondriale DNA von Säugetieren (mtDNA) strikt mütterlicherseits vererbt wird. Spermienmitochondrien verschwinden in der frühen Embryogenese durch selektive Zerstörung, Inaktivierung oder einfache Verdünnung durch den enormen Überschuss an Eizellenmitochondrien. . . Der zugrunde liegende Mechanismus, der für die Eliminierung von Spermien-mtDNA in normalen Embryonen verantwortlich ist, ist nicht gut verstanden. Wir spekulieren, dass der Prozess in einigen Fällen fehlerhaft sein könnte, wodurch die Mitochondrien der Spermien überleben und diejenigen mit einem selektiven Vorteil die Möglichkeit haben, sich in bestimmten Geweben durchzusetzen. . . Durch die Polymerase-Kettenreaktion (PCR) wurden bei Mäusen nach mehreren Generationen interspezifischer Rückkreuzungen sehr geringe Mengen väterlich vererbter mtDNA nachgewiesen. Studien an solchen Hybriden und an Maus-Oozyten, denen Spermien mikroinjiziert wurden, unterstützen die Hypothese, dass Spermienmitochondrien durch nukleär kodierte Proteine ​​zerstört werden. Wir berichten über den Fall eines 28-jährigen Mannes mit mitochondrialer Myopathie aufgrund einer neuartigen 2-bp-mtDNA-Deletion im ND2 Gen (auch bekannt als MTND2), das für eine Untereinheit des Enzymkomplexes I der mitochondrialen Atmungskette kodiert. Wir stellten fest, dass die mtDNA mit der Mutation väterlichen Ursprungs war und 90 Prozent der Muskel-mtDNA des Patienten ausmachte.“ 47

Was bedeutet ein solcher Befund in Bezug auf mtDNA-Mutationsraten und molekulare Uhren? Betrachten Sie die folgenden Kommentare von Morris und Lightowlers, die in einer Ausgabe von 2000 veröffentlicht wurden Die Lanzette:

Es wird allgemein angenommen, dass mitochondriale DNA (mtDNA) ausschließlich von der Mutter vererbt wird. Mehrere neuere Veröffentlichungen haben jedoch vorgeschlagen, dass Elemente der mtDNA manchmal vom Vater geerbt werden können. Diese Hypothese basiert auf Beweisen, dass mtDNA eine Rekombination durchlaufen kann. In diesem Fall muss die mtDNA der Mutter in der Eizelle mit homologen Sequenzen in einem anderen DNA-Molekül gekreuzt werden. Die väterliche mtDNA scheint der wahrscheinlichste Kandidat zu sein. Wenn mtDNA unabhängig vom Mechanismus rekombinieren kann, hat dies wichtige Auswirkungen auf die mtDNA-Evolution und auf phylogenetische Studien, die mtDNA verwenden. 48

Bevor dieser Beweis für eine väterliche Vererbung entdeckt wurde, wurde angenommen, dass mtDNA ausschließlich das Ergebnis einer mütterlichen Vererbung ist. Basierend auf dieser Annahme wurde angenommen, dass die mitochondrialen Nachkommen exakte Kopien der Mitochondrien der Mutter erhalten würden, es sei denn, es lag ein Mutationsfehler vor. Es wurde lange angenommen, dass diese Fehlerrate im nicht-kodierenden Teil der mitochondrialen DNA einmal alle 300 bis 600 Generationen oder alle 6.000 bis 12.000 Jahre beim Menschen auftritt.

Die Berkeley-Biochemiker, die die Theorie entwickelten, Allan Wilson, Rebecca Cann und Mark Stoneking, machten mehrere scheinbar vernünftige Annahmen. Da es keine DNA-Veränderungen aufgrund von genetischen Rekombinationsereignissen gab (dh: mit väterlicher DNA - jetzt als falsche Annahme bekannt), gingen sie davon aus, dass alle Veränderungen in der mtDNA das Ergebnis von Mutationen im Laufe der Zeit waren und dass diese Mutationen konstant auftraten Bewertung. Aufgrund dieser Annahmen glaubten die Forscher, Zugang zu so etwas wie einer „molekularen Uhr“ zu haben. Da angenommen wird, dass mtDNA schneller mutiert als nukleäre DNA (nucDNA), dachte man, dass die schnellere Mutationsrate der mtDNA eine genauere Zeitmessung als nucDNA.

Die ursprüngliche Studie aus dem Jahr 1987 umfasste mtDNA von 136 Frauen aus vielen Teilen der Welt mit unterschiedlichem rassischem Hintergrund. Die Analyse schien die Idee eines einzelnen mtDNA-Moleküls einer Vorfahren einer Frau zu unterstützen, die vor etwa 200.000 Jahren in Afrika südlich der Sahara lebte. Später schienen detailliertere Studien diese Schlussfolgerung zu bestätigen. Leider gab es jedoch sowohl im Computerprogramm als auch bei den Forschern selbst eine unentdeckte Voreingenommenheit. Die Forscher verwendeten ein Computerprogramm, das entworfen wurde, um eine "maximale Sparsamkeit"-Stammbaum oder den Stammbaum mit der geringsten Anzahl von Mutationsänderungen aufzudecken. Dies basierte auf der Annahme, dass die Evolution den direktesten und effizientesten Weg genommen hätte (was nicht unbedingt wahr oder sogar wahrscheinlich ist). Außerdem war das Computerprogramm durch die Reihenfolge der Dateneingabe voreingenommen, um die zuerst eingegebenen Informationen zu bevorzugen. Dieses Problem wurde erkannt, als der Computer je nach Reihenfolge der Dateneingabe unterschiedliche Ergebnisse lieferte. Jetzt, nach Tausenden von Computerläufen mit zufällig eingegebenen Daten, scheint es, dass der "afrikanische Ursprung" für den modernen Menschen keine statistische Signifikanz gegenüber anderen Möglichkeiten hat. 26

Die Probleme mit diesen Studien waren so groß, dass Henry Gee, ein Mitglied der Redaktion der Zeitschrift, Natur, beschrieb die Studien harsch als "Müll". Nach Betrachtung der Anzahl der beteiligten Sequenzen (136 mtDNA-Sequenzen) berechnete Gee, dass die Gesamtzahl potenziell korrekter sparsamer Bäume bei über einer Milliarde liegt. 25 Der Genetiker Alan Templeton (Washington University) schlägt vor, dass eine Vermischung der frühen menschlichen Populationen auf niedrigem Niveau die DNA-Sequenzen ausreichend verwürfelt haben könnte, so dass die Frage nach der Herkunft des modernen Menschen und einem Datum für "Eve" niemals durch mtDNA geklärt werden kann. 22 In einem Brief an Wissenschaft, bestätigte Mark Stoneking (einer der ursprünglichen Forscher), dass die Theorie einer "afrikanischen Eva" entkräftet wurde. 23

Ein weiterer interessanter Aspekt der Theorie der "molekularen Uhr" ist die Art und Weise, wie die Mutationsrate selbst bestimmt wurde. Anders als viele vielleicht denken, wurde die Mutationsrate zunächst nicht durch irgendeine direkte Analyse bestimmt, sondern durch vermeintliche phylogene evolutionäre Beziehungen zwischen Mensch und Schimpanse. Mit anderen Worten, die Mutationsrate wurde unter der Annahme berechnet, dass die fragliche Theorie bereits wahr war. Dies ist eine ziemlich zirkuläre Annahme und als solche werden alle Ergebnisse, die auf dieser Annahme basieren, mit dieser Annahme übereinstimmen - wie eine sich selbst erfüllende Prophezeiung. Da die Rate auf der Grundlage früherer Annahmen der evolutionären Zeit berechnet wurde, "bestätigen" die Ergebnisse automatisch die vorherigen Annahmen. Wenn man wirklich eine unabhängige Bestätigung einer Theorie wünscht, dann kann man den Bestätigungstest nicht durch die Theorie oder irgendeinen Teil der Theorie, der getestet wird, kalibrieren. Und doch haben Wissenschaftler wie Sarich, einer der Pioniere der Idee der molekularen Uhr, genau das getan. Sarich begann mit der Berechnung der Mutationsraten verschiedener Arten ". deren Divergenz zuverlässig anhand von Fossilien datiert werden konnte.“ Anschließend wandte er diese Kalibrierung auf die Schimpansen-Mensch-Trennung an und datierte diese Trennung vor fünf bis sieben Millionen Jahren. Unter Verwendung der Mutationskalibrierungen von Sarich wandten Wilson und Cann sie auf ihre mtDNA-Studien an und verglichen ". das Verhältnis der mitochondrialen DNA-Divergenz zwischen Menschen und Menschen und Schimpansen.“ 24 Mit dieser Methode berechneten sie, dass der gemeinsame Vorfahre aller modernen Menschen, die „afrikanische Eva“, vor etwa 200.000 Jahren lebte.

Offensichtlich müssen diese Daten, die aus der mtDNA-Analyse berechnet werden, mit der vorausgesetzten evolutionären Zeitskala übereinstimmen, da die Berechnung auf dieser Voraussetzung basiert. Die Zirkularität dieser Methode widerspricht einer guten wissenschaftlichen Methode und ist wertlos, was den unabhängigen Vorhersagewert betrifft. Die Theorie der "mitochondrialen Uhr" war und ist im Grunde eine Theorie innerhalb einer Theorie, da sie keine unabhängige Vorhersagekraft außerhalb der Evolutionstheorie hat. Es ist daher überraschend, dass Wissenschaftler diesen inhärenten Fehler nicht früher entdeckt haben. Interessanterweise wurde dieser Denkfehler jedoch viele Jahre lang nicht entdeckt und wäre vielleicht viel länger unentdeckt geblieben, wenn keine direktere Mutationsratenanalyse durchgeführt worden wäre.

Schließlich begannen Wissenschaftler, die historische Familien und ihre genetische Geschichte studieren, die Mutationsraten zu hinterfragen, die auf evolutionären phylogenetischen Annahmen beruhten. Diese Wissenschaftler waren "fassungslos", als sie feststellten, dass die Mutationsrate tatsächlich viel höher war als bisher angenommen. Tatsächlich war sie bei etwa einer Mutation alle 25 bis 40 Generationen (etwa 500 bis 800 Jahre für den Menschen) etwa 20-mal höher. Es scheint, dass sich Menschen in diesem Abschnitt der Kontrollregion, der etwa 610 Basenpaare aufweist, typischerweise durch etwa 18 Mutationen voneinander unterscheiden. 3 Aus einfacher Mathematik ergibt sich, dass der moderne Mensch vor etwa 300 Generationen einen gemeinsamen Vorfahren hat. Nimmt man eine typische Generationszeit von etwa 20 Jahren an, so liegt das Datum des gemeinsamen Vorfahren etwa 6.000 Jahre vor der Gegenwart. Aber wie kann das sein?! Thomas Parsons scheint ebenso verwirrt. Betrachten Sie seine folgenden Kommentare, die im April 1997 in der Zeitschrift veröffentlicht wurden Naturgenetik:

„Die Rate und das Muster von Sequenzsubstitutionen in der Kontrollregion (CR) der mitochondrialen DNA (mtDNA) ist von zentraler Bedeutung für Studien zur menschlichen Evolution und für forensische Identitätstests. Hier berichten wir über eine direkte Messung der intergenerationellen Substitutionsrate im humanen CR. Wir verglichen DNA-Sequenzen von zwei CR-hypervariablen Segmenten von nahen mütterlichen Verwandten aus 134 unabhängigen mtDNA-Linien mit 327 Generationenereignissen. Zehn Substitutionen wurden beobachtet, was zu einer empirischen Rate von 1/33 Generationen oder 2,5/Stelle/Myr führte. Dies ist etwa zwanzigmal höher als Schätzungen aus phylogenetischen Analysen. Diese Diskrepanz kann nicht einfach durch Substitutionen an Mutations-Hotspots erklärt werden, was auf zusätzliche Faktoren hindeutet, die die Diskrepanz zwischen sehr kurzfristigen und langfristigen scheinbaren Sequenzdivergenzraten erzeugen. Die Daten weisen auch darauf hin, dass beim Menschen eine extrem schnelle Segregation von CR-Sequenzvarianten zwischen Generationen mit einem sehr kleinen mtDNA-Engpass üblich ist. Diese Ergebnisse haben Auswirkungen auf forensische Anwendungen und Studien der menschlichen Evolution.

Die hier berichtete beobachtete Substitutionsrate ist im Vergleich zu den aus evolutionären Studien abgeleiteten Raten sehr hoch. Aus phylogenetischen Studien wurde ein breites Spektrum von CR-Substitutionsraten abgeleitet, die sich über ungefähr 0,025–0,26/Stelle/Myr. erstrecken, einschließlich Konfidenzintervallen. Eine Studie, die eine der schnelleren Schätzungen ergab, ergab eine Substitutionsrate der hypervariablen CR-Regionen von 0,118 +-0,031/Stelle/Myr. Bei einer angenommenen Generationszeit von 20 Jahren entspricht dies

1/600 Generationen und ein Alter für die mtDNA MRCA von 133.000 Jahren. Somit ist unsere Beobachtung der Substitutionsrate, 2,5/Stelle/Myr, ungefähr 20-mal höher als aus phylogenetischen Analysen vorhergesagt. Die Verwendung unserer empirischen Rate zur Kalibrierung der molekularen Uhr der mtDNA würde zu einem Alter der mtDNA-MRCA von nur . führen

6.500 Jahre, eindeutig unvereinbar mit dem bekannten Alter des modernen Menschen. Selbst wenn man anerkennt, dass der MRCA der mtDNA jünger sein kann als der MRCA des modernen Menschen, bleibt es unplausibel, die bekannte geografische Verteilung der mtDNA-Sequenzvariation durch menschliche Migration zu erklären, die nur in den letzten Jahren auftrat

Die Berechnung erfolgt folgendermaßen: Betrachten wir zwei zufällig ausgewählte Menschen. Unter der Annahme, dass alle Menschen anfangs identische mitochondriale DNA haben, werden sich nach 33 Generationen zwei solcher zufälligen menschlichen Familien wahrscheinlich durch zwei Mutationen unterscheiden, da es zwei separate Erblinien und wahrscheinlich eine Mutation entlang jeder Linie geben wird. Nach 66 Generationen unterscheiden sich zwei zufällig ausgewählte Menschen durch etwa vier Mutationen. Nach 100 Generationen unterscheiden sie sich durch etwa sechs Mutationen. Nach 300 Generationen unterscheiden sie sich um etwa 18 Mutationen, was etwa dem beobachteten Wert entspricht.

Diese Experimente sind ziemlich beunruhigend für Evolutionisten, die zuvor berechnet haben, dass der "mitochondriale Vorabend" (dessen Mitochondrien die Vorfahren aller lebenden Menschen sind) vor etwa 100.000 bis 200.000 Jahren in Afrika gelebt hat. 1 Die neuen Berechnungen, die auf den obigen Experimenten basieren, würden sie zu einer relativ jungen Frau machen

6.500 Jahre alt. Nun muss die bisherige Vorstellung, dass der moderne Mensch bis zu 10.000 Generationen alt ist, neu bewertet werden oder zumindest die mtDNA-Basis für diese Annahme neu bewertet werden - und das war es auch. 2

Neuere Studien zur direkten mtDNA-Mutationsrate scheinen auch die früheren Ergebnisse von Parsons und anderen zu bestätigen. In einem 2001 erschienenen Artikel im American Journal of Human Genetics, Evelyne Heyer et. al., präsentierten ihre Ergebnisse zur mtDNA-Mutationsrate in tief verwurzelten französisch-kanadischen Stammbäumen.

Ihre Ergebnisse "bestätigen[ed] frühere Ergebnisse von viel höheren Mutationsraten in Familien als diejenigen, die auf phylogenetischen Vergleichen basieren. . . Für die HVI-Sequenzen erhielten wir 220 Generationen oder 6.600 Jahre und für die HVII-Sequenzen 275 Generationen oder 8.250 Jahre. Obwohl jeder dieser Werte mit einer großen Varianz verbunden ist, weisen sie beide auf

7.000-8.000 Jahre und damit bis ins frühe Neolithikum als Zeit der Expansion [meist nordeuropäischen Ursprungs] . . . Unsere Schätzung der CR-Mutationsrate insgesamt von 11,6 pro Standort pro Million Generationen . . . ist höher, aber nicht signifikant anders als der Wert von 6,3, der in einer kürzlich durchgeführten Stammbaumstudie vergleichbarer Größe angegeben wurde. . . In einer anderen Studie (Soodyall et al. 1997) wurden bei 108 Übertragungen keine Mutationen nachgewiesen. Andererseits wurden von Howell et al. bei 81 Übertragungen zwei Substitutionen beobachtet. (1996) und neun Substitutionen wurden in 327 Übertragungen von Parsons et al. (1997). Die Kombination all dieser Daten (1.729 Übertragungen) ergibt eine Mutationsrate von 15,5 (Kl. 10,3-22,1). Berücksichtigt man nur solche aus tiefwurzelnden Stammbäumen (1.321 Vererbungen) (Soodyall et al. 1997 Sigurdardottir et al. 2000 die vorliegende Studie) ergibt sich der Wert 7,9. Letzteres kann, indem experimentelle Probleme mit Heteroplasmie vermieden werden, eine realistischere Annäherung an die Gesamtmutationsrate liefern.“ 44

Betrachten Sie auch ein Papier aus dem Jahr 2003, das in der veröffentlicht wurde Annalen der Humangenetik von B. Bonne-Tamir et al. wo die Autoren ihre Ergebnisse einer Studie über "mütterliche und väterliche Abstammungslinien" aus einer kleinen isolierten Samaritergemeinschaft präsentierten. In diesem Papier kamen sie zu dem Schluss:

"Verglichen mit den von anderen erhaltenen Ergebnissen zu mtDNA-Mutationsraten stimmt unsere Obergrenze der Mutationsrate von 1/61 Mutationen pro Generation sehr gut mit den zuvor veröffentlichten überein." 45 [verglichen mit der von Parsons bestimmten Rate von 1/33 Generationen, eine Rate von 1/61 ist nicht mehr als das Doppelte]

Ein weiterer interessanter Artikel, der im September 2000 im Journal veröffentlicht wurde Wissenschaftler von Denver et al. ist auch recht interessant. Diese Wissenschaftler berichteten über ihre Arbeit mit den mtDNA-Mutationsraten von Fadenwürmern und fanden heraus, dass die molekularen Uhren dieser Würmer tatsächlich um " . laufen100 mal schneller als bisher gedacht" [Hervorhebung hinzugefügt]. 46

„Eine direkte Übertragung der Ergebnisse auf den Menschen ist nicht möglich, sagen die Wissenschaftler. Aber ihre Ergebnisse unterstützen neuere umstrittene Studien, die darauf hindeuten, dass die menschliche molekulare Uhr auch 100-mal schneller läuft, als normalerweise angenommen wird. Dies könnte bedeuten, dass Schätzungen über die Divergenz zwischen Schimpansen und Menschen und das Auftauchen des modernen Menschen viel jünger sind als derzeit angenommen, sagt das Team. "Unsere Arbeit scheint Humananalysen zu unterstützen, die eine sehr hohe Rate ergeben haben", sagt Kelley Thomas von der University of Missouri. "Diese Arbeit ist für den Menschen relevant", sagt Doug Turnbill vom Institut für Humangenetik und der Newcastle University, Großbritannien. "Wenn die menschliche Mutationsrate schneller ist als gedacht, hätte dies einen großen Einfluss auf die Untersuchung menschlicher Krankheiten und Forensik sowie auf die Evolutionsrate des Menschen." . . .

Die Mutationsraten der mtDNA beim Menschen werden normalerweise durch den Vergleich von DNA-Sequenzen von Menschen und anderen Tieren geschätzt. "Diese Art von Analyse wurde verwendet, um festzustellen, dass der afrikanische Ursprung des modernen Menschen vor etwa 200.000 Jahren liegt", sagt Thomas. "Das Problem bei diesem Ansatz besteht darin, dass man sowohl die Mutationsrate als auch die Auswirkungen der natürlichen Selektion betrachtet", sagt er. Die Technik würde auch mehrere Mutationen im gleichen Abschnitt der mtDNA übersehen, sagt Paul Sharp vom Institute of Genetics der Nottingham University, Großbritannien.

Neuere Studien haben die mtDNA von Menschen untersucht, die entfernt verwandt sind, aber einen weiblichen Vorfahren haben. Dieser Ansatz hat höhere mtDNA-Mutationsraten ergeben. Aber die Ergebnisse wurden von vielen Wissenschaftlern nicht akzeptiert [Betonung hinzugefügt].

Die genaue Mutationsrate beim Menschen zu kennen ist für die forensische Wissenschaft und das Studium genetischer Erkrankungen sehr wichtig, betont Turnbill. Die forensische Identifizierung beruht oft auf dem Vergleich von DNA-Proben mit Proben von mutmaßlichen Verwandten. Schnellere menschliche molekulare Uhren könnten etablierte exakte Beziehungen erschweren, sagt er." 46

Offensichtlich sind diese Raten, die auf direkteren Beobachtungen basieren, bei weitem nicht denen, die auf indirekten evolutionären Annahmen beruhen. Das macht die Dinge jetzt sicherlich ein bisschen "kompliziert", oder? Ist es nicht seltsam, dass viele Wissenschaftler diese Ergebnisse immer noch nicht akzeptieren? Die Tendenz, sowohl die Evolution als auch Millionen von Jahren für angenommene Divergenzzeiten zwischen Kreaturen wie Affen und Menschen zu begünstigen, ist so stark, dass es so gut wie unmöglich ist, die Meinung derer, die solche Positionen innehaben, zu ändern.

Es gibt viele andere potenzielle Probleme für Phylogenien, die auf mtDNA-Sequenzanalysen und Mutationsraten beruhen. Ein Problem ist, dass mtDNA als einzelner genetischer Locus fungiert, ähnlich wie ein einzelnes Gen in nucDNA. Studien, die an einem einzigen Gen-Locus arbeiten, sind eher von zufälligen genetischen Veränderungen betroffen als Studien, die mehr als einen Gen-Locus umfassen (je mehr, desto besser). Daher sind Single-Locus-Studien bei der Charakterisierung einer Population weniger genau. Darüber hinaus sind die neuen Beweise für eine väterliche mtDNA-Vermischung ziemlich problematisch. 16

Außerdem kann, wie oben kurz erörtert, die Verwendung von Kontrollbereichen als "molekularer Taktgeber" möglicherweise nicht so gültig sein, wie zuvor erhofft. Einige Nukleotidregionen mutieren langsam, während andere relativ schnell mutieren können. 17 Diese Mutations- "Hotspots" können sogar innerhalb eines einzigen Lebens ziemlich schnell mutieren und sind bei älteren Menschen intuitiv ziemlich häufig. 18 Natürlich entstehen solche "somatischen" Mutationen in Mitochondrien verschiedener Körpergewebe und werden, sofern sie keine Gameten betreffen, nicht an die nächste Generation weitergegeben. Sie würden jedoch immer noch Auswirkungen auf phylogenetische Interpretationen haben. Wissenschaftler haben versucht, diese Probleme zu kompensieren, aber die verschiedenen Methoden haben zu unterschiedlichen Ergebnissen geführt. 19 Außerdem ergeben, wie oben erörtert, direkte Vergleiche moderner Sequenzen mit historischen Sequenzen oft sehr unterschiedliche Ergebnisse von denen, die durch indirekte Methoden geschätzt wurden, die auf aktuellen Sequenzunterschieden basieren. Für ein weiteres Beispiel einer anderen Spezies haben direkte Vergleiche moderner Pinguine mit historisch sequenzierten Pinguinen gezeigt, dass ihre mtDNA-Mutationsraten 2 bis 7 Mal schneller sind als bisher durch indirekte Methoden angenommen. 20 Einige dieser Probleme haben tatsächlich dazu geführt, dass einige Wissenschaftler aufhören, Sequenzen aus Kontrollregionen zu verwenden, um menschliche Phylogenien zu rekonstruieren. 21

Die Wissenschaftler, die weiterhin versuchen, die Hypothese der molekularen Uhr zu revidieren, haben versucht, die Uhr zu verlangsamen, indem sie gezeigt haben, dass einige mtDNA-Regionen viel langsamer mutieren als andere Regionen. Das Problem dabei ist, dass solche Regionen offensichtlich von der natürlichen Auslese betroffen sind. Mit anderen Worten, sie sind hinsichtlich Selektionsdruck nicht funktional neutral.

Echtzeitexperimente haben beispielsweise gezeigt, dass die durchschnittliche mitochondriale Genom-Mutationsrate bei etwa 6 x 10 –8 mut/Stelle/mitochondriale Generation liegt – im Einklang mit verschiedenen Schätzungen der durchschnittlichen bakteriellen Mutationsrate (Vergleich mit nDNA-Rate von 4,4 x 10 –8 mut /site/menschliche Generation). Bei einer durchschnittlichen Generationszeit von 45 Tagen sind das etwa 5 x 10 -6 Mut/Standort/Jahr und 5 Mut/Standort/Myr.

Dies ist etwa doppelt so hoch wie die Parsons-Rate von 2,5/mut/site/myr und etwa 40- bis 50-mal höher als die Raten, die auf phylogenetischen Vergleichen und evolutionären Annahmen basieren. Und dies ist die durchschnittliche Rate des gesamten mitochondrialen Genoms von 16.000 pb. Man könnte vernünftigerweise annehmen, dass alle Aspekte der hypervariablen Regionen (HVI & HVII) eine überdurchschnittlich hohe Mutationsrate aufweisen, wenn sie wirklich neutral in Bezug auf den funktionellen Selektionsdruck sind. Angesichts dessen scheinen diese "langsam mutierenden Stellen" mit Geschwindigkeiten von nur 0,065 mut/Stelle/myr (Heyer et al., 2001) durch natürliche Selektion auf eine voreingenommene Weise aufrechterhalten zu werden.

Auch hier spiegeln solche nicht neutralen Veränderungen nicht unbedingt die seit einem gemeinsamen Vorfahren verstrichene Zeit wider, sondern spiegeln die unterschiedlichen funktionalen Bedürfnisse verschiedener Kreaturen in verschiedenen Umgebungen wider.

Wie bei den mitochondrialen DNA-Mutationsraten wurden die Mutationsraten der nuklearen DNA oft auf der Grundlage von Evolutionsszenarien und nicht auf direkten Methoden berechnet. Durch solche Verfahren wurde die durchschnittliche Mutationsrate für Eukaryoten im Allgemeinen bis vor kurzem (siehe weitere Diskussion unten) auf etwa 2,2 × 10 –9 Mutationen pro Basenpaar pro Jahr geschätzt. 29 Bei einer durchschnittlichen Generationszeit von 20 Jahren für den Menschen entspricht dies etwa 4,4 x 10 –8 Mutationen pro Basenpaar pro Generation. Da die meisten Schätzungen der Größe des diploiden menschlichen Genoms etwa 6,3 Milliarden Basenpaare betragen, würde diese Mutationsrate dem durchschnittlichen Kind etwa 277 Mutationsunterschiede zu seinen Eltern geben. Dies klingt nach einer ziemlich hohen Zahl und liegt tatsächlich am oberen Ende des Spektrums im Vergleich zu Studien, die sich spezieller mit menschlichen Mutationsraten gegenüber eukaryotischen Mutationsraten im Allgemeinen befassen. Eine Originalstudie von Nachman und Crowell schien diese Schätzung jedoch durch den Vergleich von Kontrollsequenzen bei Menschen und Schimpansen zu bestätigen. Anhand dieser Sequenzvergleiche wurde "Die durchschnittliche Mutationsrate wurde auf" geschätzt

2,5 × 10 –8 Mutationen pro Nukleotidstelle oder 175 Mutationen pro diploidem Genom pro Generation“ [Basierend auf einer höheren Schätzung des diploiden Genoms von 7 Milliarden Basenpaaren]. 30

Diese Schätzungen der nicht-direkten Mutationsrate schienen auch vernünftig, da sie mit den Fehlerraten der DNA-Replikation übereinstimmen, die zwischen der Bildung einer Zygote in einer Generation und der Bildung einer Zygote in der nächsten Generation auftreten. Beachten Sie in der Abbildung 31 unten, dass von der Befruchtung bis zur Bildung der ersten funktionsfähigen Gameten einer Frau etwa 23 mitotische Teilungen erforderlich sind. Männer hingegen tragen im Durchschnitt etwa doppelt so viele Keimbahnmutationen bei wie Frauen. 33 Zumindest ein Grund dafür ist, dass sich Stammzellen bei Männern ständig teilen, so dass, je älter ein Mann wird, bevor er Kinder bekommt, mehr mitotische Teilungen auftreten.

Bedenken Sie nun, dass jede diploide befruchtete Zygote etwa 6 Milliarden Basenpaare DNA enthält (

3 Milliarden von jedem Gameten/Elternteil, wobei eine konservative runde Zahl verwendet wird). 32 Von Zellteilung zu Zellteilung beträgt die Fehlerrate für DNA-Polymerase in Kombination mit anderen Reparaturenzymen etwa 1 Fehler pro 1 Milliarde kopierter Basenpaare. 42 Bei dieser Geschwindigkeit gibt es ungefähr 6 Fehler bei jedem diploiden Zellreplikationsereignis. Bei einem männlichen/weiblichen Durchschnitt von 29 mitotischen Teilungen vor der Produktion der nächsten Generation sind dies etwa 175 Mutationen pro Generation.

Dies steht natürlich im Einklang mit den Mutationsraten, die auf evolutionären Szenarien basieren. Einige Schätzungen gehen jedoch davon aus, dass die Gesamtmutationsrate nur 1 Fehler von 10 Milliarden kopierten Basenpaaren beträgt. 43 Bei dieser Rate würde man bei jedem Replikationsereignis etwa 0,6 Fehler und nur etwa 17 Mutationen pro Person und Generation erwarten. Vielleicht passiert also noch etwas anderes, das auch die nukleare DNA-Mutationsrate beeinflusst? Wie sich herausstellt, sind Replikationsfehler nicht die einzigen Quellen für DNA-Mutationen. DNA-Schäden können und werden oft spontan auftreten. Die Stabilität des Genoms wird ständig durch eine Vielzahl mutagener Kräfte herausgefordert, darunter Fehler bei der DNA-Replikation, Umweltfaktoren wie UV-Strahlung und endogene Mutagene wie freie Sauerstoffradikale, die während des oxidativen Stoffwechsels erzeugt werden. Auch diese Schäden müssen ständig erkannt und behoben werden. Natürlich ist diese Reparatur nicht perfekt und trägt daher wahrscheinlich erheblich zur tatsächlichen Mutationsrate bei, die über die bereits diskutierten indirekten Methoden hinausgeht.

Auf der anderen Seite deuten direktere Methoden zum Nachweis der Kernmutationsraten bei Tieren darauf hin, dass die tatsächlich gemessene Rate oft ziemlich anders ist als die Raten, die durch evolutionäre Annahmen vorgeschlagen werden (sowohl höher als auch niedriger). Zum Beispiel die beobachtete Mutationsrate für C. elegans war zehnmal höher als Schätzungen, die auf indirekten Methoden und evolutionären Annahmen basieren. Betrachten Sie den folgenden Auszug aus Denver et. al. veröffentlicht in Natur in 2004:

„Alternative Ansätze bei Säugetieren, die sich auf phylogenetische Vergleiche von Pseudogen-Loci und vierfach degenerierten Codonpositionen stützen, leiden unter Unsicherheiten in der tatsächlichen Anzahl von Generationen, die die verglichenen Arten trennen, und der Unfähigkeit, Verzerrungen im Zusammenhang mit natürlicher Selektion auszuschließen. Hier bieten wir eine direkte und unverzerrte Schätzung der Kernmutationsrate und ihres molekularen Spektrums mit einer Reihe von C. elegans Mutationsakkumulationslinien, die eine etwa zehnmal höhere Mutationsrate als frühere indirekte Schätzungen und einen Überschuss an Insertionen gegenüber Deletionen aufweisen." (siehe Link)

In letzter Zeit gab es auch einige direkte Messungen der menschlichen Mutationsraten, die nicht ganz mit den auf evolutionären Annahmen basierenden Raten übereinstimmen. Eine in Science veröffentlichte Arbeit versuchte eine direkte Messung der Mutationsrate durch den Vergleich der vollständigen Genomsequenzen zweier Nachkommen und ihrer Eltern. Sie schätzen, dass jedes Nachkommen nur 70 neue Mutationen hatte, bei einer Mutationsrate von 1,1 x 10 -8 pro haploidem Genom pro Generation (Roach et al. 2010: Link). Diese Rate gilt für ein haploides Genom, was einer Rate von . entspricht

140 Mutationen pro diploidem Genom (d. h. ziemlich nahe an der oben angegebenen Rate für ein diploides Genom von

170 Mutationen pro Generation). Wenn es stimmt, müsste der Zeitpunkt der Divergenz von Mensch und Schimpanse auf 9 Myr festgelegt werden, und viele Studien der jüngsten menschlichen Evolution könnten um einen Faktor von mindestens zwei abweichen.

Also, was ist die große Sache? Nun, bei einer Mutationsrate von 140 pro Person und Generation und der Tatsache, dass die meisten Mutationen funktionelle Mutationen schädlich sind, wie kann der menschliche Genpool im Laufe der Zeit nicht degenerieren? Dies hätte als ein bedeutendes Rätsel erkannt werden können, wenn nicht bis etwa 2014 ein Großteil des menschlichen Genoms von den meisten Wissenschaftlern lange Zeit als ohne signifikante funktionelle Rolle angesehen wurde. Es wurde daher angenommen, dass es daher eine ziemlich große Anzahl von Mutationen ohne signifikante nachteilige Auswirkungen auf die Gesamtfunktion des Organismus ertragen kann. Die Menge dieser nicht-funktionellen DNA wurde einmal geschätzt, indem man den kodierenden Teil der DNA berechnete und diesen von der gesamten genomischen Fläche abzog. Angesichts des durchschnittlichen kodierenden Anteils eines menschlichen Gens mit einer Größe von etwa 1.350 Basenpaaren (Kodierung für ein Protein mit einer Größe von etwa 450 Aminosäuren) muss man diese Zahl nur mit der Gesamtzahl der Gene multiplizieren, um eine vernünftige Schätzung zu erhalten der Gesamtmenge der kodierenden genetischen Immobilien - ursprünglich angenommen, dass sie zwischen 2-5% des Genoms liegen.

Über die Gesamtzahl der Gene im menschlichen Genom herrschte jedoch lange Zeit Uneinigkeit. Viele Jahre lang wurde angenommen, dass der Mensch zwischen 70.000 und 140.000 Gene besitzt. Wissenschaftler, die am Humangenomprojekt arbeiten, machten jedoch eine überraschende Entdeckung. Als sie im Februar 2001 einen groben Entwurf des Projekts fertigstellten, schätzten sie die tatsächliche Genzahl auf 30.000 bis 40.000 Gene. 39 Aber ein Jahr später, im Februar 2002, auf der Jahrestagung der American Association for the Advancement of Science (Herausgeber von Wissenschaft), wies einer der Moderatoren, Victor Velculescu, darauf hin, dass die tatsächliche Zahl der Gene im menschlichen Genom tatsächlich eher bei 70.000 Genen liegen könnte. 40

Natürlich liegt die aktuelle Schätzung für die Anzahl der Gene im Genom wieder bei 20-30.000. Diese Zahl ist jedoch fast irrelevant, da jetzt festgestellt wird, dass nicht-proteinkodierende Teile der DNA, wie viele sogenannte Pseudogene und Miro-RNAs, eine signifikante Funktionalität aufweisen – zusammen mit anderen riesigen Abschnitten nicht-kodierender DNA. Tatsächlich wird jetzt vermutet, dass ein erheblicher Teil des menschlichen Genoms funktionsfähig ist, wobei Schätzungen zwischen 16 und 20 % liegen (Kellis, 2014). Einige Schätzungen sind sogar noch höher (siehe Link). Diese Zunahme der bekannten Menge an funktionellem Platz innerhalb des Genoms macht es viel wahrscheinlicher, dass eine zufällige Mutation tatsächlich funktionell relevant ist. Das mag angesichts einer Mutationsrate von etwa 170 Mutationen pro Person und Generation wie ein ziemlich bedeutendes Problem erscheinen. Ab 2012 deuten jedoch direkte Messungen der nucDNA-Mutationsraten basierend auf der Analyse moderner Familienlinien darauf hin, dass die tatsächliche nucDNA-Mutationsrate bei etwa 70 Punktmutationen pro Person und Generation liegt (Peter D. Keightley, 2012) – was weniger als die Hälfte von . ist die bisherigen Schätzungen. Dies hilft zwar jemandem bei dem Problem der nachteiligen Mutationsrate, löst das Problem jedoch nicht wirklich, da die Menge an bekanntem genetischem Vermögen, das tatsächlich in einem oder anderen Maße funktionsfähig ist, viel signifikanter ansteigt.

Gemeinsamer Vorfahr von Menschen und Menschenaffen "Mit den Dinosauriern leben"?

Interessant nebenbei ist, dass diese reduzierte nucDNA-Mutationsrate die DNA-basierte "Uhr" sich signifikant ändert, wie lange Menschen und Affen wieder einen gemeinsamen Vorfahren haben sollen - von ungefähr sechs Millionen bis ungefähr "vor 40 Millionen Jahren." (Callaway, 2012). "Diese sehr langsame Uhr hat den gemeinsamen Vorfahren von Affen und Menschen, die mit den letzten Dinosauriern koexistieren." Dies ist ein Problem, das David Reich (Department of Genetics, Harvard Medical School) hervorhebt, indem er feststellt:

Es wird sehr in der Tat kompliziert. Tatsächlich würde ich sagen, dass "sehr kompliziert" eine Untertreibung ist, wenn man den gemeinsamen Vorfahren von Menschen und Affen hat, der mit den Dinosauriern zusammenlebt.

und der genetische Verfall der Menschheit

Diejenigen, die diese Frage ursprünglich untersuchten, schlugen eine schädliche Mutationsrate (Ud) von 1 bis 3 pro Person und Generation vor, wobei zumindest einige Wissenschaftler (Nachmann und Crowell, 2000) mindestens 3 oder mehr befürworteten. 30 Natürlich sind die tatsächlichen schädlichen Mutationsraten, wie oben kurz erwähnt, wahrscheinlich viel höher. In jedem Fall schien es selbst unter diesen anfänglichen Annahmen (da schädliche Mutationen nützliche Mutationen um mindestens 1.000 zu 1 übersteigen) so, als ob die Ansammlung schädlicher Mutationen in einer Population zum Aussterben führen könnte. 34,36

Nachmann und Crowell beschreiben diese verwirrende Situation in der folgenden Schlussfolgerung aus ihrem Papier über menschliche Mutationsraten:

Die hohe schädliche Mutationsrate beim Menschen stellt ein Paradox dar. Wenn Mutationen multiplikativ interagieren, wäre die mit einer so hohen U [schädliche Mutationsrate] verbundene genetische Belastung bei Arten mit niedriger Reproduktionsrate [wie Menschen und Affen etc.] nicht tolerierbar. . .

Die Verminderung der Fitness (d. h. der genetischen Belastung) durch schädliche Mutationen mit multiplikativer Wirkung wird durch 1 - e -U angegeben (Kimura und Moruyama 1966).Für U = 3 wird die durchschnittliche Fitness auf 0,05 reduziert, oder anders ausgedrückt, jedes Weibchen müsste 40 Nachkommen für 2 produzieren, um zu überleben und die Population konstant zu halten. Dies geht davon aus, dass die gesamte Sterblichkeit auf Selektion zurückzuführen ist und daher die tatsächliche Anzahl der Nachkommen, die erforderlich ist, um eine konstante Populationsgröße aufrechtzuerhalten, wahrscheinlich höher ist.

Das Problem kann durch weiche Selektion oder durch Selektion früh in der Entwicklung (z. B. in utero) etwas gemildert werden. Viele Mutationen sind jedoch bedingungslos schädlich und es ist unwahrscheinlich, dass das Fortpflanzungspotenzial für menschliche Weibchen im Durchschnitt 40 Zygoten erreichen kann. Dieses Problem kann überwunden werden, wenn die meisten schädlichen Mutationen synergistische Epistase aufweisen, dh wenn jede zusätzliche Mutation zu einer größeren Abnahme der relativen Fitness führt. Im Extremfall führt dies zu einer Trunkierungsselektion, bei der alle Individuen, die mehr als eine Schwellenzahl von Mutationen tragen, aus der Population eliminiert werden. Während eine extreme Trunkationsselektion unrealistisch erscheint [der Tod all derer mit einem schädlichen Mutationsgleichgewicht], deuten die hier präsentierten Ergebnisse darauf hin, dass eine Form von positiver Epistase unter schädlichen Mutationen wahrscheinlich ist. 30

Nachmann und Crowell fanden diese Situation sehr rätselhaft. Wie wird man all die schlechten Mutationen schneller los, als sie produziert werden? Sie schlugen mehrere mögliche Lösungen vor, wie zum Beispiel ein Konzept, das sie "positive Epistase" nannten. Wenn jedoch die funktionellen Effekte von Mutationen multiplikativ statt additiv verstärkt würden, würde dies das Problem lösen? Wie oben erwähnt, würde die reproduktive Belastung der Überlebenden selbst dann nicht abnehmen, wenn jede schädliche Mutation den Tod ihres Besitzers verursachen würde, sondern gleich bleiben.

Nehmen wir zum Beispiel an, dass alle mit mindestens drei schädlichen Mutationen sterben, bevor sie sich fortpflanzen. Der Bevölkerungsdurchschnitt würde bald knapp über 3 schädlichen Mutationsraten liegen. Über 95 % jeder nachfolgenden Generation würden 3 oder mehr schädliche Mutationen aufweisen, verglichen mit der ursprünglichen "neutralen" Population. Die Sterberate würde dramatisch ansteigen. Um Schritt zu halten, müssten die Reproduktionsraten der überlebenden Individuen proportional zur erhöhten Sterberate steigen. Dasselbe würde schließlich passieren, wenn die Todesgrenze bei 100, 500, 1000, 10000 oder mehr schädlichen Mutationen gezogen würde. Der einzige Unterschied wäre die Zeitdauer, die eine gegebene Population benötigen würde, um eine tödliche Anzahl von schädlichen Mutationen in ihrem Genpool aufzubauen, beginnend an einem relativ "neutralen" Startpunkt. Die Population könnte viele Generationen lang ziemlich gut überleben, ohne auf eine enorme Steigerung der Reproduktionsrate zurückgreifen zu müssen. Ohne die sich anhäufenden schädlichen Mutationen zu beseitigen, würde die Bevölkerung jedoch schließlich einen exponentiellen Anstieg ihrer Sterblichkeitsrate erleben, wenn ihre durchschnittliche Bevölkerung die Grenze der tödlichen Mutationen überschreitet.

Da die Theorie der positiven Epistase der Situation nicht viel zu helfen scheint, muss ein anderer Prozess gefunden werden, um zu erklären, wie man bevorzugt schädliche Mutationen aus einer Population loswird. Betrachten Sie einen Auszug aus a Wissenschaftlicher Amerikaner 1999 veröffentlichter Artikel mit dem Titel "Mutations Galore":

Nach der gängigen Theorie der Populationsgenetik impliziert die Zahl von drei schädlichen Mutationen pro Person und Generation, dass für jede Person, die sich fortpflanzt, drei Menschen in jeder Generation vorzeitig sterben (oder sich nicht reproduzieren) müssten, um die jetzt fehlenden schädlichen Mutationen zu eliminieren [ 75% Sterberate]. Der Mensch reproduziert sich nicht schnell genug, um eine so hohe Zahl von Todesopfern zu ertragen. Wie James F. Crow von der University of Wisconsin in einem Kommentar in Natur zur Analyse von Eyre-Walker und Keightley: "Warum sind wir nicht ausgestorben?"

Crows Antwort ist, dass Sex, der Gene herummischt, es ermöglicht, schädliche Mutationen in Bündeln zu beseitigen. Die neuen Erkenntnisse unterstützen somit die Idee, dass sich Sex entwickelt hat, weil Individuen, die (dank Sex) mehrere schlechte Mutationen geerbt haben, den Genpool von allen auf einmal befreien, indem sie nicht überleben oder sich reproduzieren.

Doch mit dem Aufkommen der modernen Medizin hat sich die natürliche Selektion in der menschlichen Bevölkerung abgeschwächt, stellt Crow fest. Daher vermutet er, dass sich schädliche Mutationen jetzt mit einer noch höheren Rate anhäufen könnten, mit möglicherweise besorgniserregenden Folgen für die Gesundheit. Keightley ist skeptisch: Er glaubt, dass viele leicht schädliche Mutationen durch zufällige Ereignisse in der Evolution bereits in der menschlichen Bevölkerung weit verbreitet sind und dass verschiedene Anpassungen, insbesondere die Intelligenz, mehr als kompensiert haben. "Ich bezweifle, dass wir eine Strafe zahlen müssen, wie Crow zu denken scheint", bemerkt er. "Wir sind bis jetzt ganz gut zurechtgekommen." 37

Vielleicht könnte die Antwort dann in einer Kombination von Prozessen gefunden werden, bei denen sowohl die sexuelle Replikation als auch die natürliche Selektion eine Rolle spielen, um zu verhindern, dass eine sich langsam fortpflanzende Population ausstirbt. Betrachten Sie zum Beispiel die folgende Grafik, die zeigt, wie sich schädliche Mutationen in einer Population aufbauen, die sich auf asexuelle Weise fortpflanzt: 49

Beachten Sie, wie sich die am besten geeigneten Verlustzahlen der "Vorläuferklasse" (P) in jeder Generation ansammeln, während sich die Zahlen derjenigen, die eine größere Anzahl schädlicher Mutationen aufweisen, immer mehr anhäufen. In diesem Artikel stellt Rice fest, dass in asexuellen Populationen der einzige Weg, diese Ansammlung schädlicher Mutationen wirklich zu überwinden, darin besteht, die Reproduktionsrate erheblich zu erhöhen. Aber was ist mit nützlichen Mutationen? Rice kommentiert: „Seltene umgekehrte und kompensatorische Mutationen können durch genetisches Trampen schädliche Mutationen gegen den Fluss der genetischen Polarisierung bewegen. Aber dies ist ein geringer Einfluss, analog zu Wasserturbulenzen, die gelegentlich einen Kieselstein eine kurze Strecke flussaufwärts transportieren.“ 49 Wie könnten sich also sexuell reproduzierende Populationen dieses Problem lösen?

Wenn es um sich sexuell fortpflanzende Populationen geht, ermöglicht die Fähigkeit zur genetischen Rekombination bei der Bildung von Gameten, sowohl gute als auch schlechte Mutationen zu konzentrieren. Nehmen wir zum Beispiel an, wir haben zwei Individuen mit jeweils 2 schädlichen Mutationen. Angesichts der sexuellen Rekombination zwischen diesen beiden Individuen besteht eine gute Chance, dass einige ihrer Nachkommen (1 Chance von 32) keine vererbten schädlichen Mutationen haben. Aber was passiert, wenn die Rate zusätzlicher schädlicher Mutationen recht hoch ist? - sagen wir 3 pro Individuum pro Generation?

Um dies noch etwas genauer zu untersuchen, betrachten wir ein weiteres Beispiel einer Steady-State-Population von 5.000 Individuen, die jeweils mit 7 schädlichen Mutationen und einer durchschnittlichen schädlichen Mutationsrate von 3 pro Individuum und Generation beginnen. Bei einer Reproduktionsrate von 4 Nachkommen pro jedes der 2.500 Paare (10.000 Nachkommen), wie viele Nachkommen werden in einer Generation die gleichen oder weniger schädliche Mutationen haben als die Elterngeneration?


Klonale Selektion als alternativer Mechanismus zur Erzeugung multipler Mutationen

Die Hypothese, dass die Tumorprogression aufeinanderfolgende Wellen klonaler Selektion beinhaltet, wurde ursprünglich von Nowell (2) aufgestellt. Unter dieser Hypothese verleiht jede ausgewählte Mutation einen proliferativen Vorteil, was zu aufeinanderfolgenden klonalen Abstammungslinien führt. Das Auftreten sequenzieller Chromosomenveränderungen wurde beim malignen Melanom (39) und am häufigsten beim Adenokarzinom des Dickdarms (40) nachgewiesen. Ein Problem bei der Idee von sequentiellen Mutationen gefolgt von einer stringenten Selektion besteht darin, dass jede Mutation einen großen selektiven Vorteil bieten müsste, sogar rezessive Mutationen, die nur in einem von zwei Allelen vorkommen. Obwohl ein sequentielles Modell für die Mutationsakkumulation für die Entstehung des menschlichen Dickdarmkrebses vorgeschlagen wurde (40), wurde gezeigt, dass nur ein kleiner Bruchteil der Tumoren (6,6%) die drei am häufigsten abgegrenzten Mutationen enthält (41). Diese Ergebnisse deuten darauf hin, dass mehrere Mutationen zusätzlich zu den häufig gefundenen an der Entstehung von Dickdarmkrebs beteiligt sein können.

Ein Mutator-Phänotyp und die Selektion auf Mutationen in spezifischen Onkogenen und Tumorsuppressorgenen schließen sich in der Tat nicht aus. Darüber hinaus können diese Prozesse voneinander abhängig sein. Sequenzielle Selektionsrunden für Mutationen, die die Proliferation in E coli zu einer Population von Zellen führen, die einen Mutator-Phänotyp exprimieren (42). Bei jeder Selektionsrunde auf verschiedene vorteilhafte Mutationen gibt es gleichzeitige Selektion auf Mutationen in Genen, die die Mutationen in diesen Genen erzeugen (d. h. Mutatormutanten). Ein ähnliches Trampen von Mutatorgenen während sequentieller Selektionsrunden wurde auch in Hefe nachgewiesen (R. Kolodner, persönliche Mitteilung) und könnte auf das Wachstum von Tumoren angewendet werden, bei denen Mutanten ausgewählt werden, die unter verschiedenen Bedingungen einen Wachstumsvorteil aufweisen. Hanahan und Weinberg (43) haben in einer umfassenden Analyse sechs wesentliche Veränderungen in der Zellphysiologie identifiziert, die das maligne Wachstum steuern. Jede dieser Veränderungen kann Mutationen erfordern, die einen selektiven Wachstumsvorteil bieten und gleichzeitig Mutatorallele anreichern können. Somit können sowohl die klonale Selektion als auch die Erzeugung von Mutatormutanten während der Tumorprogression wirksam sein, und der vorherrschende Weg kann in verschiedenen Tumoren unterschiedlich sein.


Zugangsoptionen

Erhalten Sie vollen Zugriff auf Zeitschriften für 1 Jahr

Alle Preise sind Nettopreise.
Die Mehrwertsteuer wird später an der Kasse hinzugefügt.
Die Steuerberechnung wird während des Bezahlvorgangs abgeschlossen.

Erhalten Sie zeitlich begrenzten oder vollständigen Artikelzugriff auf ReadCube.

Alle Preise sind Nettopreise.


Materialen und Methoden

Bakterienstämme und Medien.

Der Wildtyp-Stamm PFM2 ist ein prototrophes Derivat des E coli K12-Referenzstamm MG1655 (73, 74). Der MutL-Stamm PFM5 ist ein Derivat von PFM2 mit dem mutL Gen durch eine Narbensequenz im Leserahmen ersetzt (75). Details zu den verwendeten genetischen Techniken und Medien finden Sie in SI-Materialien und -Methoden.

Schätzung von Mutationsraten durch Fluktuationstests.

Mutationsraten zu Nal R oder Rif R wurden unter Verwendung von Fluktuationstests wie beschrieben geschätzt (76). Weitere Details finden Sie in SI-Materialien und -Methoden.

MA-Verfahren.

MA-Linien stammten aus einzelnen Kolonien, die jeden Tag auf LB-Agarplatten isoliert wurden, jede Linie wurde für einzelne Kolonien auf einer LB-Agarplatte, zwei Linien pro Platte, ausgestrichen und bei 37 °C für 24 h inkubiert. Um Verzerrungen zu vermeiden, war die für die Passage ausgewählte Kolonie eine gut isolierte Kolonie, die einer Linie, die in der Mitte der Platte gezogen wurde, am nächsten war. Ursprünglich wurden 100 Linien des Wildtyp-Stamms und 70 Linien des MutL – -Stamms gestartet, aber Verluste traten während der Passage (wenn keine einzelne Kolonie erhalten wurde), der DNA-Präparation, der Bibliothekskonstruktion und aufgrund von Linienmehrdeutigkeiten auf (siehe Gemeinsame Mutationsanalyse unter). Jeder dieser Schritte führte zu einer Verringerung von etwa 20 %, was zu der in Tabelle 1 angegebenen Anzahl von Linien führte. Die Verluste waren zufällig und sollten die Ergebnisse daher nicht beeinflussen. In keinem Fall ging eine Linie verloren, weil sie ausstarb. Weitere Details finden Sie in SI-Materialien und -Methoden.

Schätzung von Generationen und Zelllebensfähigkeit in Kolonien.

Die Anzahl der Generationen pro Passage, geschätzt aus der Anzahl der Zellen in Kolonien mit einem gegebenen Durchmesser, betrug normalerweise 28 Generationen. Der Anteil toter Zellen in resuspendierten Kolonien, der mit dem Live/Dead BacLight BacLight Bacterial Viability Kit (Invitrogen, Inc) bestimmt wurde, betrug 0,05 ± 0,01 (Mittelwert ± SEM). Weitere Details finden Sie in SI-Materialien und -Methoden.

Genomische DNA-Präparation.

Das PureLink Genomic DNA-Reinigungskit (Invitrogen Corp.) wurde verwendet, um genomische DNA aus 0,5–1 ml LB-Übernachtkulturen zu reinigen, die aus den Gefrierbeständen geimpft wurden. DNA-Konzentration und -Reinheit wurden unter Verwendung eines NanoDrop ND-1000-Spektrophotometers (Thermo Fisher Scientific, Inc.) bestimmt.

Sequenzierung und Qualitätskontrolle.

Die Sequenzierung wurde am Beijing Genome Institute (BGI) unter Verwendung der Illumina HiSeq2000-Plattform durchgeführt. Für jede MA-Linie wurden ∼101 (470 Mbp) Paired-End-Reads (2 × 90 bp) beibehalten, nachdem Reads verworfen wurden, die nicht der Qualitätskontrolle von BGI entsprachen. Lesevorgänge mit einem der folgenden Merkmale wurden verworfen: (ich) ≥10% unlesbare Basen (ii) ≥20% minderwertig (≤Q20) Basen (iii) Adapterkontamination (≥15-bp-Überlappung, die bis zu 3-bp-Fehlpaarung ermöglicht) oder (NS) doppelte Lesepaare. Nach einer solchen Filterung wurden durchschnittlich 91,1% der Reads zurückbehalten.

SNP und Short Indel Calling.

Die Referenzgenomsequenz war die NCBI-Referenzsequenz NC_000913.2. Für jede Probe wurden die Illumina-Reads auf die E coli K12 (Stamm MG1655) Genom mit dem Short Read Alignment Tool, BWA (Version 0.5.9) (77). Kurze Indels (≤4 bp) wurden basierend auf dem Read-Mapping der SNP-Calling-Prozeduren aufgerufen. Weitere Details finden Sie in SI-Materialien und -Methoden.

Mutationsbestätigung durch konventionelle Sequenzierung.

Wir wählten zufällig 19 BPSs aus den Wildtyp-3K-MA-Linien (∼20% der Gesamtmenge) zur Bestätigung aus. Da es im Allgemeinen schwieriger ist, Indels genau zu callen als SNPs (78), haben wir alle 10 der kleinen Indels überprüft, die aus der Wildtyp-3K-MA-Linie aufgerufen wurden. Es gab keine falschen Anrufe im BPS-Datensatz. Ein indel, das als −G aufgerufen wurde, war tatsächlich eine Löschung von 24 nt in einem Wiederholungselement, alle anderen indel-Aufrufe waren korrekt. Weitere Details finden Sie in SI-Materialien und -Methoden.

Mutationsanmerkung.

Mehrere benutzerdefinierte Skripte wurden geschrieben, um Kandidatenvarianten mit Anmerkungen zu versehen. Die Koordinaten der Protein-kodierenden Gene wurden von der GenBank-Seite der NCBI-Referenzsequenz NC_000913.2 erhalten. BPS wurden basierend auf dem genetischen Code als synonym, nicht-synonym oder nicht-kodierend bestimmt. Nichtsynonyme BPS wurden anhand der BLOSUM62-Matrix (79) als konservativ oder nichtkonservativ bezeichnet, ein Wert ≥0 galt als konservativ.

Gemeinsame Mutationsanalyse.

Die Wildtyp- und MutL − -Stämme erlebten ∼80 und

75 Wachstumsgenerationen, als ihre Phänotypen überprüft wurden und als sie eingefroren und nachgewachsen wurden, bevor der erste Engpass für das MA-Protokoll entstand. Somit könnten MA-Linien Mutationen teilen, die während dieses Zeitraums auftraten. Sequenz-Alignment und Abstammungsanalyse wurden verwendet, um Mutationen zu unterscheiden, die unabhängig von denen entstanden sind, die einen gemeinsamen Vorfahren hatten. Weitere Details finden Sie in SI-Materialien und -Methoden.

Monte-Carlo-Simulationen.

Ein benutzerdefiniertes Skript wurde geschrieben, um eine zufällige Verteilung von BPSs entsprechend den beobachteten Mutationsspektren zu simulieren. Der Einfachheit halber wurde die Anzahl der Mutationen auf die beobachteten Zahlen festgelegt, 1000 Versuche wurden simuliert.


Schau das Video: DES-Mutation (Januar 2023).