Information

Verlassen snRNAs den Zellkern oder nicht?

Verlassen snRNAs den Zellkern oder nicht?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

In Molekularbiologie der Zelle (Alberts, et al., 2015) listet sie die verschiedenen RNAs auf, die durch den Nuclear Pore Complex (NPC) in das Zytoplasma transportiert werden.

Die Liste enthält snRNAs, aber ich habe an anderer Stelle gesehen, dass snRNAs den Zellkern nicht verlassen, dass sie dort hergestellt werden und dort ihre Funktion erfüllen.

Ist die Version von MBOC korrekt und verlassen die snRNAs den Kern, oder sind die anderen Quellen korrekt und die snRNAs werden hergestellt, bleiben und funktionieren im Kern?


Nach der Transkription einiger UsnRNAs verlassen die RNAs zuerst die Kerne. Nach dem Zusammenbau verschiedener Proteine ​​und der Modifikation der RNAs im Zytosol kehren die RNAs in die Zellkerne zurück. Außerdem wurde gezeigt, dass reifes U6snRNP in Hefen zwischen nuklearen und zytosolischen Fraktionen hin- und herpendelt, wenn ich mich richtig erinnere.

http://openi.nlm.nih.gov/detailedresult.php?img=2582628_gkn658f1&req=4


Rolle von Wirtsfaktoren beim subzellulären Transport von Gag-Proteinen und genomischer RNA, die zur Virion-Assemblierung führen

Eunice C. Chen , Leslie J. Parent , in Retrovirus-Zell-Interaktionen , 2018

Spumaretrovirus-RNA-Kernexport

Der Kernexport des viralen Genoms in Spumaretroviren, wie dem Prototyp-Foamy-Virus (PFV), nutzt einen Mechanismus, der eine Mischung aus einfachen und komplexen Retroviren darstellt ( Abb. 8.1 ). Der Kernexport in PFV ist Crm1-abhängig, was durch eine verminderte Gag-Expression in infektiösen Provirus-transfizierten 293T-Zellen nach einer Behandlung mit Leptomycin B (LMB) belegt wird (Bodem et al., 2011). PFV kodiert jedoch kein virales Protein, das mit Crm1 interagiert. Stattdessen basiert PFV auf einem zellulären RNA-bindenden Protein HuR und den Adapterproteinen ANP32A/B, um die Interaktion zwischen dem viralen Genom und Crm1 zu überbrücken. Es wird angenommen, dass diese Wechselwirkung eine direkte Wechselwirkung ist, da sie durch RNA-Protein-Vernetzungs- und Immunpräzipitationstechniken zwischen dem viralen Genom und markierten Proteinen identifiziert wurde. Die Mechanismen dieser Interaktion sind jedoch nicht vollständig geklärt, da die für HuR-RNA-Wechselwirkungen üblicherweise erforderliche sekundäre RNA-Struktur in der PFV-RNA nicht identifiziert wurde (Bodem et al., 2011 Prechtel et al., 2006).


Biogenese von spleißosomalen snRNPs

Mit Ausnahme von U6 werden die wichtigsten spleißosomalen snRNAs (U1, U2, U4 und U5) von Pol II synthetisiert. Die Pol-II-spezifischen snRNAs erhalten eine Monomethylguanosin (7mGpppG)-Cap-Struktur und ihre Primärtranskripte werden weit über das 3'-Ende der reifen RNA hinaus verlängert. Stabile prä-snRNA-Zwischenprodukte, die nur einen kurzen (5-10 nt) 3′-Überhang tragen, werden durch ein transkriptionsgebundenes Prozessierungsereignis erzeugt, das eine cis-wirkende Signalsequenz (3′-Kasten) und Phosphorylierung der C-terminalen Domäne des erfordert größte Untereinheit von Pol II (Medlin et al., 2003). Die presnRNA wird zu einem großen Exportkomplex zusammengesetzt, der den 7mG-Cap-Bindungskomplex (CBC), den phosphorylierten Adapter für den RNA-Export (PHAX) und den CRM1/RanGTP-Komplex umfasst. Nach dem Export in das Zytoplasma durch den Kernporenkomplex (NPC) induzieren Dephosphorylierung von PHAX und GTP-Hydrolysen von Ran den Abbau des snRNA-Exportkomplexes (Ohno et al., 2000).

Im Zytoplasma erleichtert das Überleben des Proteinkomplexes der Motoneuronen (SMN) den Zusammenbau von prä-snRNA mit einem heteroheptameren Ring aus sieben Sm-Proteinen - B/B′, D1, D2, D3, E, F und G -, um die snRNP-Kernkomplex (Paushkin et al., 2002). Die Sm-Proteine ​​binden an die konservierte Sm-Bindungsstelle (Sm, Konsensus RAUU U /gUUGR) von Pol-II-spezifischen spleißosomalen snRNAs. Die Bindung von Sm-Proteinen ist Voraussetzung für die Hypermethylierung des 7mG-Caps zu 2,2,7-Trimethylguanosin (TMG) durch die Tgs1-Methyltransferase sowie für die exonukleolytische Entfernung der 3'-Trailer-Sequenzen. Die neu synthetisierte TMG-Kappe und die assoziierten Sm-Proteine ​​liefern das Kernlokalisierungssignal für den zytoplasmatischen Kern-snRNP. Der Reimport von Sm snRNPs in den Zellkern wird durch drei Faktoren vermittelt: Snurportin-1 (SPN1), das die TMG-Kappe des snRNA-Importins β erkennt, das mit SPN1 assoziiert und einem nicht identifizierten Importrezeptor, der mit Sm-Proteinen (Sm IR) interagiert ( Palacios et al., 1997).

Nach dem Wiedereintritt in das Nukleoplasma dissoziieren die Importproteine ​​und die neu importierten snRNPs reichern sich vorübergehend in Cajal-Körpern an (Sleeman und Lamond, 1999). Im Cajal-Körper durchlaufen die snRNAs U1, U2, U4 und U5 eine ortsspezifische Pseudouridylierung (Ψ) und 2′-O-Methylierung (m), die durch scaRNAs gesteuert wird, die sich spezifisch in Cajal-Körpern anreichern (Jády et al., 2003) . Neben den üblichen Sm-Kernproteinen enthalten die reifen U1, U2, U4 und U5 snRNPs auch speziesspezifische RNP-Proteine. Da sich die snRNP-spezifischen Proteine ​​in Cajal-Körpern zu konzentrieren scheinen, wird angenommen, dass sie mit den Kern-snRNPs in dieser Organelle assoziieren.

Schließlich akkumulieren reife spleißosomale snRNPs in der Interchromatin-Region in Strukturen, die als Splicing Speckles bezeichnet werden. Normalerweise befinden sich Speckles in der Nähe von aktiv transkribierten Genen. Sie bieten wahrscheinlich Speicherorte für snRNPs oder wirken beim snRNP-Recycling (Lamond und Spector, 2003). Es ist wichtig anzumerken, dass mehrere Laboratorien unter verschiedenen Bedingungen über eine geringe nukleoläre Lokalisation von Sm-snRNPs berichtet haben (Gerbi et al., 2003, Sleeman und Lamond, 1999). Leider bleibt die funktionelle Bedeutung der vorübergehenden Akkumulation von Sm-snRNAs im Nukleolus mutmaßlich. Die Biogenese der Pol-II-spezifischen U11-, U12- und U4atac-kleinen spleißosomalen snRNPs folgt wahrscheinlich dem Reifungsweg der wichtigsten Sm-snRNPs.

Im Gegensatz zu den Pol-II-spezifischen Sm-snRNAs ist die Biogenese der Pol-III-transkribierten U6-snRNA auf den Zellkern beschränkt. Bevor sich die reifende U6-snRNA in den nukleoplasmatischen Spleißflecken ansammelt, besucht sie den Nukleolus und den Cajal-Körper. Die Synthese von U6-snRNA endet innerhalb einer kurzen U-Strecke, die als Transkriptionsterminationssignal für Pol III dient. Die 3'-terminale U-Strecke der neu synthetisierten U6-RNA assoziiert vorübergehend mit dem La-Protein, das der entstehenden RNA Stabilität verleiht und den snRNP-Zusammenbau erleichtert (Wolin und Cedervall, 2002). Später wird das La-Protein durch das Donut-ähnliche Heteromer von sieben Sm-ähnlichen Proteinen (Lsm2, Lsm3, Lsm4, Lsm5, Lsm6, Lsm7 und Lsm8) ersetzt (Achsel et al., 1999). Die Struktur des Lsm-Rings ist noch nicht bekannt.

Während ihrer Reifung erfährt die U6-snRNA auch eine ortsspezifische Pseudouridylierung und 2'-O-Methylierung. Im Gegensatz zu Sm-snRNAs, die im Cajal-Körper durch scaRNPs modifiziert werden, wird die 2′-O-Methylierung und wahrscheinlich auch Pseudouridylierung der U6-snRNA jedoch durch snoRNAs gesteuert, die sich im Nukleolus befinden. Dies weist darauf hin, dass U6 den Nukleolus durchläuft, um snoRNA-vermittelte Modifikationen zu durchlaufen (Ganot et al., 1999 Lange und Gerbi, 2000). Die Bindung des Lsm-Proteinkomplexes ist für das Targeting von U6-snRNA zum Nukleolus und anschließend zum Cajal-Körper essentiell (Gerbi und Lange, 2002). Die reifen U6- und U4-snRNPs existieren in einem gemeinsamen U4-U6-disnRNP, das auch das U5-snRNP bindet, um das U4-U6-U5-Tri-snRNP zu bilden. Die jüngste Entdeckung, dass SART3/p110, ein Proteinfaktor, der die U4-U6-Zusammensetzung erleichtert, im Cajal-Körper konzentriert ist, deutet darauf hin, dass die Assemblierung des U4-U6-snRNP in dieser Organelle stattfinden könnte (Stanek et al., 2003). Es ist unklar, ob sich U5-snRNP im Cajal-Körper oder später im Nukleoplasma mit U4-U6-di-snRNP verbindet. Die reife U6-snRNA trägt eine γ-Monomethylphosphat (mpppG)-Cap-Struktur (Singh und Reddy, 1989), aber es bleibt unbekannt, in welchem ​​Stadium der U6-Biogenese die mpppG-Cap synthetisiert wird.


Verweise

Golgi, C. Sur la Struktur des cellules nerveuses. Bogen. Ital. Biol. 30, 60–71 (1898).

Cajal, S.R.y. Eine sencillo metodo de coloracion seletiva del reticulo protoplasmatico y sus efectos en los diversos organos nerviosos of vertebrados and invertebrados. Trab. Labor. Investieren. Biol. (Madrid) 2, 129–221 (1903).

Gall, J. G., Bellini, M., Wu, Z. &. Murphy, C. Zusammenbau der nuklearen Transkriptions- und Verarbeitungsmaschinerie: Cajal-Körper (Coiled Bodies) und Transkriptosomen. Mol.-Nr. Biol. Zelle 10, 4385–4402 (1999).

Jörgensen, M. & Zellenstudien, I. Morphologische Beiträge zum Problem des Eiwachstums. Bogen. Zellforsch. 10, 1–126 (1913).

Bier, K., Kunz, W. & Ribbert, D. Struktur und Funktion der Oocytenchromosomen und Nukleolen sowie der Extra-DNS während der Oogenese panoistischer und meroistischer Insekten. Chromosom 23, 214–254 (1967).

Gall, J. G. Lampbrush-Chromosomen aus Eizellenkernen des Molches. J. Morphol. 94, 283–352 (1954).

Callan, H. G. Neuere Arbeiten zur Struktur von Zellkernen. in Fine Structure of Cells: Symposium of the VIIIth Congress in Cell Biology, Leiden 1954, International Union of Biological Sciences Publ., Reihe B 21, 89–109 (1954).

Gall, J. G., Stephenson, E. C., Erba, H. P., Diaz, M. O. & Barsacchi-Pilone, G. Histon-Gene befinden sich an den Sphären-Loci der Molchlampenbürsten-Chromosomen. Chromosom 84, 159–171 (1981).

Callan, H. G., Gall, J. G. & Murphy, C. Histon-Gene befinden sich an den Sphären-Loci von Xenopus Lampenbürstenchromosomen. Chromosom 101, 245–251 (1991).

Gall, J. G. & Callan, H. G. Die Kugel-Organelle enthält kleine nukleäre Ribonukleoproteine. Proz. Natl Acad. Wissenschaft Vereinigte Staaten von Amerika 86, 6635–6639 (1989).

Wu, Z., Murphy, C., Callan, H.G. &. Gall, J.G. Kleine nukleäre Ribonukleoproteine ​​und heterogene nukleäre Ribonukleoproteine ​​im amphibischen Keimbläschen: Schleifen, Kugeln und Snurposomen. J. Cell Biol. 113, 465–483 (1991).

Wu, C.-H. H. &. Gall, J. G. U7 kleine nukleäre RNA in C-Snurposomen der Xenopus Keimbläschen. Proz. Natl Acad. Wissenschaft Vereinigte Staaten von Amerika 90, 6257–6259 (1993).

Wu, C.-H. H., Murphy, C. &. Gall, J.G. Die Sm-Bindungsstelle zielt auf U7-snRNA zu Coiled Bodies (Kugeln) von Amphibien-Oozyten. RNA 2, 811–823 (1996).

Frey, M. R. & Matera, A. G. Coiled Bodies enthalten kleine nukleäre U7-RNA und assoziieren mit spezifischen DNA-Sequenzen in menschlichen Interphase-Zellen. Proz. Natl Acad. Wissenschaft Vereinigte Staaten von Amerika 92, 5915–5919 (1995).

Monneron, A. & Bernhard, W. Feine strukturelle Organisation des Interphase-Kerns in einigen Säugerzellen. J. Ultrastruktur. Res. 27, 266–288 (1969).

Hardin, J. H., Spicer, S. S. & Greene, W. B. Die paranukleoläre Struktur, der akzessorische Körper von Cajal, das Geschlechtschromatin und verwandte Strukturen in den Kernen von Trigeminusneuronen der Ratte: eine zytochemische und ultrastrukturelle Studie. Anat. Empf. 164, 403–432 (1969).

Lafarga, M. & Hervas, J.P. in Ramon y Cajals Beitrag zu den Neurowissenschaften (Hrsg. Grisolia, S., Guerri, C., Samson, F., Norton, S. &. Reinoso-Suárez, F.) 91-100 (Elsevier Science Publishers, 1983).

Fakan, S., Leser, G. & Martin, T. E. Ultrastrukturelle Verteilung von nuklearen Ribonukleoproteinen, wie durch Immunzytochemie auf dünnen Schnitten sichtbar gemacht. J. Cell Biol. 98, 358–363 (1984).

Lafontaine, J. G. Eine licht- und elektronenmikroskopische Untersuchung kleiner kugelförmiger Kernkörper in meristematischen Zellen von Allium cepa, Vicia Faba, und Raphanus sativus. J. Cell Biol. 26, 1–17 (1965).

Chamberland, H. & Lafontaine, J. G. Lokalisierung von snRNP-Antigenen in Nukleolus-assoziierten Körpern: Untersuchung von Pflanzen-Interphase-Kernen durch konfokale und Elektronenmikroskopie. Chromosom 102, 220–226 (1993).

Ras̆ka, I. et al. Immunologische und ultrastrukturelle Untersuchungen des Nuclear Coiled Body mit Autoimmunantikörpern. Erw. Zellres. 195, 27–37 (1991).

Andrade, L.E.C. et al. Humaner Autoantikörper gegen ein neues Protein des Nuclear Coiled Body: Immunologische Charakterisierung und cDNA-Klonierung von p80-Coilin. J. Erw. Med. 173, 1407–1419 (1991).

Beven, A.F., Simpson, G.G., Brown, J.W.S. & Shaw, P.J. Die Organisation der spleiosomalen Komponenten in den Kernen höherer Pflanzen. J. Cell Sci. 108, 509–518 (1995).

Tuma, R.S., Stolk, J.A. & Roth, M.B. Identifizierung und Charakterisierung eines Kugelorganellenproteins. J. Cell Biol. 122, 767–773 (1993).

Wu, Z., Murphy, C. &. Gall, J.G. Humanes p80-Coilin wird auf Kugelorganellen im Amphibienkeimvesikel gerichtet. Mol.-Nr. Biol. Zelle 5, 1119–1127 (1994).

Gall, J. G., Tsvetkov, A., Wu, Z. & Murphy, C. Ist die Kugelorganelle/der gewendelte Körper eine universelle Kernkomponente? Abw. Genet. 16, 25–35 (1995).

Bauer, D. W. &Amp Gall, J. G. Aufgerollte Körper ohne Coilin. Mol.-Nr. Biol. Zelle 8, 73–82 (1997).

Tucker, K. E. et al. Restliche Cajal-Körper in Coilin-Knockout-Mäusen können Sm snRNPs und SMN, das Genprodukt der spinalen Muskelatrophie, nicht rekrutieren. J. Cell Biol. 154, 293–307 (2001).

Bellini, M. Coilin, mehr als ein molekularer Marker des Cajal-Körpers. Bioessays 22, 861–867 (2000).

Carmo-Fonseca, M. et al. Säugetierkerne enthalten Herde, die stark mit Komponenten der Prä-mRNA-Spleißmaschinerie angereichert sind. EMBO J. 10, 195–206 (1991).

Carmo-Fonseca, M., Pepperkok, R., Carvalho, M. T. & Lamond, A. I. Transkriptionsabhängige Kolokalisation der U1, U2, U4/U6 und U5 snRNPs in Coiled Bodies. J. Cell Biol. 117, 1–14 (1992).

Huang, S. & Spector, D. L. U1- und U2-Kleinkern-RNAs sind in Kernflecken vorhanden. Proz. Natl Acad. Wissenschaft Vereinigte Staaten von Amerika 89, 305–308 (1992).

Matera, A. G. & Ward, D. C. Nukleoplasmatische Organisation kleiner nukleärer Ribonukleoproteine ​​in kultivierten menschlichen Zellen. J. Cell Biol. 121, 715–727 (1993).

Lamond, A.I.& Earnshaw, W.C. Struktur und Funktion im Zellkern. Wissenschaft 280, 547–553 (1998).

Matera, A. G. Nuclear Bodies: facettenreiche Subdomänen des Interchromatinraums. Trends Zellbiol. 9, 302–309 (1999).

Gall, J. G. Cajal Körper: die ersten 100 Jahre. Annu. Rev. Cell Dev. Biol. 16, 273–300 (2000).

Liu, Q. & Dreyfuss, G. Eine neuartige Kernstruktur, die das Überleben von Motoneuronen-Protein enthält. EMBO J. 15, 3555–3565 (1996).

Schul, W. et al. Die RNA-3'-Spaltungsfaktoren CstF 64 kDa und CPSF 100 kDa sind in Kerndomänen konzentriert, die eng mit Coiled Bodies und neu synthetisierter RNA verbunden sind. EMBO J. 15, 2883–2892 (1996).

Schul, W., van Driel, R. &. de Jong, L. Coiled-Bodies und U2-snRNA-Gene neben Coiled-Bodies sind mit Faktoren angereichert, die für die snRNA-Transkription erforderlich sind. Mol.-Nr. Biol. Zelle 9, 1025–1036 (1998).

Darzacq, X. et al. Cajal-Körper-spezifische kleine nukleäre RNAs: eine neue Klasse von 2′-Ö-Methylierung und Pseudouridylierung führen RNAs. EMBO J. 21, 2746–2756 (2002).

Richard, P. et al. Ein gemeinsames Sequenzmotiv bestimmt die Cajal-Körper-spezifische Lokalisation von Box H/ACA scaRNAs. EMBO J. 22, 4283–4293 (2003).

Jády, B. E. & Kiss, T. Eine kleine nukleoläre Leit-RNA funktioniert sowohl in 2′-Ö-Ribose-Methylierung und Pseudouridylierung der U5-spleißosomalen RNA. EMBO J. 20, 541–551 (2001).

D.A. Samarsky, M.J. Fournier, R.H. Singer & E. Bertrand. EMBO J. 17, 3747–3757 (1998).

Carvalho, T. et al. Das Genprodukt der spinalen Muskelatrophie, SMN: eine Verbindung zwischen der snRNP-Biogenese und dem Cajal-Körper (Coiled-Körper). J. Cell Biol. 147, 715–727 (1999).

Narayanan, A., Speckmann, W., Terns, R. & Terns, M.P. Rolle des Box-C/D-Motivs bei der Lokalisierung kleiner nukleolärer RNAs an Coiled Bodies und Nukleolen. Mol.-Nr. Biol. Zelle 10, 2131–2147 (1999).

Sleeman, J. E. & Lamond, A. I. Neu zusammengesetzte snRNPs assoziieren mit Coiled Bodies vor Speckles, was auf einen nuklearen snRNP-Reifungsweg hindeutet. Curr. Biol. 9, 1065–1074 (1999).

Handwerger, K. E., Murphy, C. & Gall, J. G. Steady-state dynamics of Cajal body components in the Xenopus Keimbläschen. J. Cell Biol. 160, 495–504 (2003).

Sleeman, J. E., Trinkle-Mulcahy, L., Prescott, A. R., Ogg, S. C. &, Lamond, A. I. Cajal-Körperproteine ​​SMN und Coilin zeigen ein differentielles dynamisches Verhalten in vivo. J. Cell Sci. 116, 2039–2050 (2003).

Boudonck, K., Dolan, L. & Shaw, P.J. Die Bewegung von gewundenen Körpern, visualisiert in lebenden Pflanzenzellen durch das grün fluoreszierende Protein. Mol.-Nr. Biol. Zelle 10, 2297–2307 (1999).

Platani, M., Goldberg, I., Swedlow, J.R. &. Lamond, A. In vivo Analyse der Cajal-Körperbewegung, -Trennung und -Verbindung in lebenden menschlichen Zellen. J. Cell Biol. 151, 1561–1574 (2000).

Platani, M., Goldberg, I., Lamond, A. I. & Swedlow, J. R. Cajal Körperdynamik und Assoziation mit Chromatin sind ATP-abhängig. Naturzelle Biol. 4, 502–508 (2002).

Verheggen, C. et al. U3-SnoRNPs von Säugetieren und Hefe werden in spezifischen und verwandten nukleären Kompartimenten gereift. EMBO J. 21, 2736–2745 (2002).

Jády, B.E. et al. Die Modifikation von kleinen nukleären Sm-RNAs erfolgt im nukleoplasmatischen Cajal-Körper nach dem Import aus dem Zytoplasma. EMBO J. 22, 1878–1888 (2003).

Verheggen, C. et al. Kasten C/D Transport kleiner nukleolärer RNA umfasst kleine nukleoläre RNP-Proteine, nukleoläre Faktoren und eine neue nukleäre Domäne. EMBO J. 20, 5480–5490 (2001).

Meister, G. & Fischer, U. Assistierte RNP-Assemblierung: SMN- und PRMT5-Komplexe kooperieren bei der Bildung spleißosomaler UsnRNPs. EMBO J. 21, 5853–5863 (2002).

Pellizzoni, L., Yong, J. & Dreyfuss, G. Wesentliche Rolle des SMN-Komplexes bei der Spezifität der snRNP-Assemblierung. Wissenschaft 298, 1775–1779 (2002).

Hebert, M. D., Szymczyk, P. W., Shpargel, K. B. & Matera, A. G. Coilin bildet die Brücke zwischen Cajal-Körpern und SMN, dem Protein der spinalen Muskelatrophie. Gene Dev. 15, 2720–2729 (2001).

Cajal, S.R.y. El núcleo de las células piramidales del cerebro humano y de algunos mamiferos. Trab. Labor. Investieren. Biol. Univ. Madrid 8, 27–62 (1910).

Bellini, M. &. Gall, J. G. Coilin kann einen Komplex mit dem kleinen nukleären Ribonukleoprotein U7 bilden. Mol.-Nr. Biol. Zelle 9, 2987–3001 (1998).

Smith, K.P., Carter, K.C., Johnson, C.V. & Lawrence, J.B. U2- und U1-snRNA-Genloci assoziieren mit Coiled Bodies. J. Zelle. Biochem. 59, 473–485 (1995).

Zhu, Y., Tomlinson, R.L., Lukowiak, A.A., Terns, R.M. & Terns, M.P. Telomerase-RNA akkumuliert in Cajal-Körpern in menschlichen Krebszellen. Mol.-Nr. Biol. Zelle 3 Okt 2003 [epub vor Druck].


DMCA-Beschwerde

Wenn Sie der Meinung sind, dass über die Website verfügbare Inhalte (wie in unseren Nutzungsbedingungen definiert) eines oder mehrere Ihrer Urheberrechte verletzen, benachrichtigen Sie uns bitte durch eine schriftliche Mitteilung („Verletzungsmitteilung“) mit den unten beschriebenen Informationen an die benannten unten aufgeführten Agenten. Wenn Varsity Tutors als Reaktion auf eine Verletzungsmitteilung Maßnahmen ergreift, wird es nach Treu und Glauben versuchen, die Partei zu kontaktieren, die diesen Inhalt zur Verfügung gestellt hat, über die neueste E-Mail-Adresse, die Varsity Tutors gegebenenfalls von dieser Partei zur Verfügung gestellt hat.

Ihre Verletzungsmitteilung kann an die Partei, die den Inhalt zur Verfügung gestellt hat, oder an Dritte wie ChillingEffects.org weitergeleitet werden.

Bitte beachten Sie, dass Sie für Schäden (einschließlich Kosten und Anwaltsgebühren) haftbar sind, wenn Sie fälschlicherweise angeben, dass ein Produkt oder eine Aktivität Ihre Urheberrechte verletzt. Wenn Sie sich also nicht sicher sind, ob Inhalte, die sich auf der Website befinden oder auf die von ihr verlinkt wird, Ihr Urheberrecht verletzen, sollten Sie zuerst einen Anwalt kontaktieren.

Bitte befolgen Sie diese Schritte, um eine Anzeige zu erstatten:

Sie müssen Folgendes enthalten:

Eine physische oder elektronische Unterschrift des Urheberrechtsinhabers oder einer Person, die befugt ist, in seinem Namen zu handeln Eine Identifizierung des Urheberrechts, von dem behauptet wird, dass es verletzt wurde Eine Beschreibung der Art und des genauen Ortes des Inhalts, von dem Sie behaupten, dass er Ihr Urheberrecht verletzt, in ausreichend Details, damit Hochschullehrer diesen Inhalt finden und eindeutig identifizieren können. Zum Beispiel benötigen wir einen Link zu der spezifischen Frage (nicht nur den Namen der Frage), der den Inhalt und eine Beschreibung des spezifischen Teils der Frage enthält – ein Bild, a Link, Text usw. – Ihre Beschwerde bezieht sich auf Ihren Namen, Ihre Adresse, Telefonnummer und E-Mail-Adresse und eine Erklärung von Ihnen: (a) dass Sie in gutem Glauben der Ansicht sind, dass die Nutzung der Inhalte, von denen Sie behaupten, dass sie Ihr Urheberrecht verletzen, nicht gesetzlich oder vom Urheberrechtsinhaber oder seinem Vertreter autorisiert ist, (b) dass alle in Ihrer Verletzungsmitteilung enthaltenen Informationen korrekt sind und (c) unter Strafe des Meineids, dass Sie entweder der Urheberrechtsinhaber oder eine Person, die bevollmächtigt ist, in seinem Namen zu handeln.

Senden Sie Ihre Beschwerde an unseren benannten Vertreter unter:

Charles Cohn Varsity Tutors LLC
101 S. Hanley Road, Suite 300
St. Louis, MO 63105


Wir danken Karla Neugebauer, Edouard Bertrand, David Drechsel, Angus Lamond, Yaron Shav-Tal, Pavel Draber und Maria Carmo-Fonseca für die Bereitstellung der Reagenzien und Gabi Heyne für die hervorragende technische Unterstützung. Wir danken den Mitgliedern des Stanek-Labors für die kritische Lektüre.

Autorenbeitrag: A. R. entwarfen und führten die meisten Experimente durch (Abbildungen 1–6) und beteiligte sich am Schreiben des Manuskripts C.W. isolierte 12S, 15S und 17S U2 snRNPs, C.G. präparierte und mikroinjizierte Kern-, vorreife und reife snRNP-Partikel (Abbildungen 5 und 7) K.K. stellten minimale U4snRNA-MS2 her und führten Immunpräzipitation mit U4-MS2-, U2-MS2-Konstrukten und Sm-Mutanten durch und nahmen am Schreiben des Manuskripts teil J.P. führte die snRNA-Strukturvorhersage durch und D.S., R.L. und C.G. entwarf und wertete Experimente aus und schrieb das Manuskript.


Neu synthetisierte kleine nukleäre RNAs erscheinen vorübergehend im Zytoplasma ☆

Neu synthetisierte kleine nukleäre RNA (snRNA)-Spezies Ul und U2 lassen sich leicht in zytoplasmatischen Fraktionen identifizieren, die durch standardmäßige wässrige Zellfraktionierung hergestellt wurden. Da jedoch die reifen stabilen snRNA-Spezies während der Zellfraktionierung aus isolierten Kernen austreten, besteht die Möglichkeit, dass diese neu synthetisierten Spezies auch aus dem Kern austreten. Um die Probleme des Kernlecks zu überwinden, wurden Maus-L929-Zellen durch Zell-Enukleation fraktioniert. Die Enukleation extrudiert die Kerne aus Cytochalasin-behandelten Zellen und produziert Zytoplasten, die nach mehreren Kriterien a Bona Fide zytoplasmatische Fraktion, die nicht durch Kernmaterial kontaminiert ist. Alle sechs der wichtigsten snRNAs sind kurz nach der Synthese in den Zytoplasten (c-snRNAs) vorhanden. Die Spezies werden durch Immunpräzipitation mit spezifischen Antiseren gegen die Ribonukleoproteine ​​und durch Northern Blotting und Hybridselektion unter Verwendung klonierter Sonden identifiziert. Dies bestätigt und erweitert ähnliche Studien, die nicht-wässrige Zellfraktionierung und manuelle Dissektion verwendeten, um Kernlecks zu überwinden. Kinetische Studien zeigen, dass die c-snRNAs nach ungefähr 20 Minuten im Zytoplasma in den Interphase-Kern zurückkehren. Der U2-Vorläufer U2′ wird in den Zytoplastenfraktionen zu U2 von reifer Größe prozessiert, bevor er in den Zellkern zurückkehrt. Die c-snRNAs treten in Ribonukleoprotein-Partikeln mit ähnlicher Antigenität wie die reifen Kernpartikel innerhalb von sechs Minuten nach der Transkription auf. Dies legt nahe, dass in Säugerzellen wichtige Schritte beim Zusammenbau dieser Ribonukleoproteine ​​im Zytoplasma ablaufen.


Zelluläre Dynamik kleiner RNAs

Diese Übersicht hebt den unerwartet komplizierten nuklearen Austritt und den nuklearen Import von kleinen RNAs hervor. Obwohl angenommen wurde, dass der Handel mit Nukleus/Zytoplasma auf die snRNAs vieler, aber nicht aller Eukaryoten beschränkt ist, deuten neuere Daten darauf hin, dass ein solcher Verkehr möglicherweise häufiger vorkommt als bisher angenommen. Erstens deuten neue Informationen im Widerspruch zu zahlreichen früheren Berichten darauf hin, dass die snRNAs von Saccharomyces cerevisiae zwischen dem Zellkern und dem Zytoplasma zirkulieren können. Zweitens liefern neuere Studien auch Beweise dafür, dass andere kleine RNAs, die ausschließlich im Kern funktionieren – die knospende Hefe-Telomerase-RNA und möglicherweise kleine nukleoläre RNAs – in das Zytoplasma austreten können, nur um zum Kern zurückzukehren. Drittens findet der Zellkern/Zytoplasma-Zyklus von RNAs auch bei RNAs statt, die ausschließlich im Zytoplasma funktionieren, da entdeckt wurde, dass zytoplasmatische tRNAs von knospenden Hefen "retrograd" zum Zellkern und möglicherweise wieder zurück zum Zytoplasma wandern, um in Proteinen zu funktionieren Synthese. Viertens gibt es in Ciliaten mindestens ein Beispiel für kleine doppelsträngige RNAs, die mehrere Zyklen zwischen dem Zytoplasma und verschiedenen Kernen wandern, um die Genomstruktur zu steuern. In diesem Bericht werden Daten diskutiert, die die bidirektionale Bewegung von Zellkern/Zytoplasma für jede Kategorie kleiner RNA unterstützen oder dagegen sprechen, und die möglichen Rollen, die eine solche Bewegung spielen könnte.


Materialen und Methoden

TsBN2-Zellkultur, Fluoreszenz-in-situ-Hybridisierung und Immunfluoreszenz

Die temperaturempfindliche mutierte RCC1-Zelllinie tsBN2 (Ohtsubo et al., 1987) wurde in Dulbecco's modifiziertem Eagle-Medium (Sigma), ergänzt mit 10 % fötalem Rinderserum, bei 33ºC kultiviert. Die Lokalisierung von U3-snoRNA sowohl bei der permissiven (33 °C) als auch bei der nicht permissiven (40 °C) Temperatur wurde durch Fluoreszenz-in-situ-Hybridisierung (FISH) bestimmt, wie an anderer Stelle beschrieben (http://singerlab.aecom.yu.edu/). Protokolle). Kurz gesagt wurden die Zellen auf Deckgläschen bei ungefähr 80% Konfluenz ausgesät und über Nacht anhaften gelassen, und dann wurde die Hälfte dieser Deckgläschen auf 40ºC verschoben. Die Zellen wurden in 4% Formaldehyd (Electron Microscopy Science), 10% Essigsäure (Sigma), 1 × PBS 2 und 6 Stunden nach der Temperaturverschiebung fixiert. Parallel auf 33 °C gehaltene Zellen wurden ebenfalls zu den gleichen Zeitpunkten fixiert. Nach Permeabilisierung mit 70 % Ethanol über Nacht bei 4 °C wurden die Zellen mit 2 × SSC, 50 % Formamid rehydratisiert und mit 30 ng Cy3-konjugierter U3-spezifischer Antisense-Desoxyoligonukleotidsonde für 3 Stunden bei 37 °C in Hybridisierungspuffer ( 10 % Dextransulfat, 2 mM Vanadyl-Ribonukleosid-Komplex, 0,02 % RNAse-freies BSA, 40 μg E coli tRNA, 2 × SSC und 50% Formamid). Die menschliche U3-Sonde (erhalten von Operon Technologies), die verwendet wurde, ist 5'GQTCTCTCCCTCQCACTCCCCAAQACGGAGAGAAGAACGAQCATCAATGGCQG 3', wobei Q Aminoallyl-modifizierte T-Reste anzeigt, die für die Cy3-Kopplung eingebaut sind. Cy3 wurde von Amersham Pharmacia Biotech bezogen und die Kopplung wurde gemäß den Empfehlungen des Herstellers durchgeführt. Das modifizierte Oligo wurde unter Verwendung eines Nukleotidentfernungskits (Qiagen) von nichtreaktivem Cy3-Farbstoff gereinigt. Gekoppelte Sonden wurden auf 8% nicht denaturierenden Polyacrylamidgelen laufen gelassen und durch UV-Beleuchtung nachgewiesen, um die Effizienz der Kopplung und Gewinnung nach der Reinigung abzuschätzen. Die indirekte Immunfluoreszenz wurde wie an anderer Stelle beschrieben (http://singerlab.aecom.yu.edu/protocols) unter Verwendung einer 1:100-Verdünnung von Anti-Trimethyl-Guanosin-Cap (TMG)-Antikörpern (Bringmann et al., 1983) und einer 1:100-Verdünnung durchgeführt. 50 Verdünnung von Cy2-konjugierten Anti-Kaninchen-Sekundärantikörpern (Jackson Immunoresearch Laboratories). Deckgläser wurden auf Objektträger mit 90 % Glycerin in 1 × PBS mit 1 mg/ml&supmin; aufgebracht P-Phenylendiamin und 1μg/ml 4,6-Diamino-2-phenylindol (DAPI).

Hefestämme und Medien

Alle Hefestämme wurden in Hefeextrakt-Pepton-Dextrose-(YEPD)-Medium unter Standardbedingungen gezüchtet (Adams et al., 1997). Der relevante Genotyp für den Wildtyp-Stamm ACY192 ist Matteein ura3-52, trp1-63,leu21. Die folgenden temperaturempfindlichen Mutanten wurden ebenfalls verwendet: ACY212, Matteein GSP1::HIS3 GSP2::HIS3 ura3-52 leu21, trp163 (transformiert mit a gsp1-1, LEU, AMP, CEN Plasmid (pAC413) oder mit a gsp1-2, LEU,AMP, CEN Plasmid (pAC414)) (Wong et al., 1997) ACY109 Matteein prp20-1 trp1 leu21 ura3 (Amberg et al., 1993) und ACY61, Matteein rna1-1 leu21 ura3-52 his3(Corbettet al., 1995a).

Hefefluoreszenz in situ Hybridisierung und Immunfluoreszenz

FISH-Analyse und Immunfluoreszenz in Hefe wurden wie beschrieben durchgeführt (Amberg et al., 1992 Wong et al., 1997), außer dass Cy3-markierte DNA-Sonden verwendet wurden. Die Antisense-Desoxyoligonukleotidsonden gegen Hefe U3 snoRNA (5′ATTCAGTGCTCTTTTGAAGAGTCAAAGAGTGACGATTCCTATAGAAATGA 3′), snR10 snoRNA(5′ CAGACGACAGAAAGACTGTTGCACCCAAGATCGATAAATTTGTTCTCCAGTCC 3′ Cy3-Label am 5′-Ende. Kurz gesagt wurden die Stämme in YEPD bei Raumtemperatur gezüchtet und für 3 Stunden auf 37ºC gebracht. Formaldehyd-fixierte Zellen wurden geerntet, mit 300 µg Zymolyase 100T (US Biological) sphäroplastisch behandelt, in P-Lösung (1,2 M Sorbit in 0,1 M Kaliumphosphatpuffer, pH 6,5) resuspendiert und auf 14-Well-Objektträger mit Teflonbeschichtung (CellPoint Scientific, Inc.) mit 0,1% Polylysin vorbeschichtet. Nach der Permeabilisierung mit 0,5% IGEPAL wurde die Hybridisierung unter Verwendung von 100-150 ng Cy3-markierter Sonde über Nacht bei 37°C durchgeführt. In einigen Experimenten wurde auch eine indirekte Immunfluoreszenz wie zuvor beschrieben (Wong et al., 1997) unter Verwendung einer 1:1000-Verdünnung von monoklonalen Anti-Nop1p (A66)-Antikörpern (Aris und Blobel, 1988) und einer 1:50-Verdünnung von Texas . durchgeführt -Rot-konjugierte Anti-Maus-Sekundärantikörper (Jackson Immunoresearch Laboratories). Die Zellen wurden mit 1 μg/ml 4,6-Diamino-2-phenylindol (DAPI) gefärbt, luftgetrocknet und in 1 mg P-Phenylendiamin/ml 90% Glycerin in 1 × PBS.

Xenopus laevis Eizellen-Mikroinjektion und RNA-Analyse

Die Kernretention und nukleoläre Lokalisation von mikroinjizierter, fluoreszenzmarkierter U3-snoRNA oder U65-snoRNA wurde wie zuvor beschrieben untersucht (Narayanan et al., 1999a Narayanan et al., 1999b Speckmann et al., 1999) in Xenopus Eizellen, bei denen das Ran-System unter Verwendung von Ran T24N zerstört wurde. Die RNAs für die Mikroinjektion wurden in vitro mit einem Fluorescein-12-UTP-Marker (zum Nachweis durch Fluoreszenzmikroskopie) und einem 32 P-GTP-Marker (zum Nachweis durch Gelelektrophorese und Autoradiographie) transkribiert. Die rekombinante T24N-Mutante Ran wurde exprimiert und gereinigt aus E coli wie zuvor beschrieben (Lounsbury et al., 1996). 32 P-markierte U1sm – snRNA (und U3-snoRNA in 5C und D) wurde mit den Fluorescein-markierten RNAs als Kontrollen für den RNA-Kernexport (oder die Retention) injiziert. 40 μmol Ran T24N in 10 nl Mikroinjektionspuffer (10 mM NaH2Bestellung4, pH 7,2, 70 mM KCl, 1 mM MgCl2 und 10 mg/ml blaues Dextran) oder 10 nl Mikroinjektionspuffer allein wurden in die Kerne von Oozyten im Stadium V/VI injiziert. Die Oozyten wurden 1 Stunde bei 18°C ​​inkubiert, bevor eine zweite Kerninjektion mit 1 fmol Fluorescein/ 32 P-GTP-markiertem U3 oder U65 erfolgte. Zur Analyse der intranuklearen Lokalisation wurden die Oozyten bei 18°C ​​inkubiert und die Kerne wurden vier Stunden nach Injektion der RNA seziert. Der Inhalt jedes sezierten Kerns wurde auf einen Objektträger übertragen. Die Objektträger wurden zentrifugiert, fixiert, montiert und der Fluoreszenzmikroskopie wie beschrieben unterzogen (Narayanan et al., 1999a Narayanan et al., 1999b). Zur Analyse der nukleozytoplasmatischen Verteilung wurde RNA aus den nuklearen und zytoplasmatischen Fraktionen von anderen der Gruppe der injizierten Oozyten extrahiert, und die radioaktiv markierten RNAs wurden durch 8% denaturierende Gelelektrophorese und Autoradiographie nachgewiesen.

Mikroinjizierte U3- und U65-snoRNAs werden im Zellkern zurückgehalten und in den Nukleolen von lokalisiert Xenopus Oozyten nach Injektion von T24N Ran. (A, C) Rekombinantes RanT24N in Mikroinjektionspuffer (untere Felder) oder Mikroinjektionspuffer allein (obere Felder) wurde in separate Sätze von Oozyten injiziert. Eine Stunde später wurde ein fmol fluoreszierender und 32 P-markierter U3- oder U65-snoRNA in denselben Satz von Oozyten injiziert. Kernausbreitungen wurden vier Stunden nach der Injektion der RNA gemacht und die Objektträger wurden durch Fluoreszenzmikroskopie analysiert. Mehrere einzelne Nukleolen sind in jedem Differentialinterferenzkontrast (DIC)-Panel gezeigt. Die Fluoreszenzsignale (RNA) zeigen, dass die injizierten snoRNAs auf eine zentral gelegene Unterregion der Nukleolen in Oozyten gerichtet sind, denen das T24N Ran (+T24N) injiziert wurde. (B, D) Nuklear (N) und zytoplasmatisch (C) Fraktionen wurden aus dem gleichen Satz von injizierten Zellen erhalten. RNA wurde aus den N- und C-Fraktionen extrahiert und einer denaturierenden PAGE unterzogen, gefolgt von einer Autoradiographie. Die Markierungsspur (M) zeigt Proben vor der Injektion an.

Mikroinjizierte U3- und U65-snoRNAs werden im Zellkern zurückgehalten und in den Nukleolen von lokalisiert Xenopus Oozyten nach Injektion von T24N Ran. (A, C) Rekombinantes RanT24N in Mikroinjektionspuffer (untere Felder) oder Mikroinjektionspuffer allein (obere Felder) wurde in separate Sätze von Oozyten injiziert. Eine Stunde später wurde ein fmol fluoreszierender und 32 P-markierter U3- oder U65-snoRNA in denselben Satz von Oozyten injiziert. Kernausbreitungen wurden vier Stunden nach der Injektion der RNA gemacht und die Objektträger wurden durch Fluoreszenzmikroskopie analysiert. Mehrere einzelne Nukleolen sind in jedem Differentialinterferenzkontrast (DIC)-Panel gezeigt. Die Fluoreszenzsignale (RNA) zeigen, dass die injizierten snoRNAs auf eine zentral gelegene Unterregion der Nukleolen in Oozyten gerichtet sind, denen das T24N Ran (+T24N) injiziert wurde. (B, D) Nuklear (N) und zytoplasmatisch (C) Fraktionen wurden aus dem gleichen Satz injizierter Zellen erhalten. RNA wurde aus den N- und C-Fraktionen extrahiert und einer denaturierenden PAGE unterzogen, gefolgt von einer Autoradiographie. Die Markierungsspur (M) zeigt Proben vor der Injektion an.

Mikroskopie

Die Mikroskopie wurde unter Verwendung eines invertierten Fluoreszenzmikroskops Zeiss Axiovert S 100 durchgeführt, das mit einer Differentialinterferenzkontrastoptik ausgestattet war (Thornwood, NY, USA). Bilder wurden unter Verwendung einer gekühlten ladungsgekoppelten Gerätekamera (Quantix-Photometrix, AZ, USA) und der IP Lab Spectrum-Software (Signal Analytics, VA) aufgenommen.


Schau das Video: snRNA u0026 SPLICEOSOMES (Oktober 2022).