Information

Wenn die Telomerlänge gemessen wird, wird die Methode an einer Sammlung von Zellen durchgeführt und ergibt einen Durchschnitt?

Wenn die Telomerlänge gemessen wird, wird die Methode an einer Sammlung von Zellen durchgeführt und ergibt einen Durchschnitt?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Welche Methoden werden zur Messung von Telomeren bei Menschen oder Tieren verwendet?

Kann es auf einer einzelnen Zelle durchgeführt werden?

Wurden die folgenden Bedenken bereits angesprochen und angesprochen:

Was ist, wenn es eine natürliche Varianz der Telomerlänge von Zelle zu Zelle gibt und es verschiedene Methoden gibt (anstrengendes Training usw.), die einen Selektionsdruck auf die Telomerlänge ausüben, dann haben Sie, wenn die Messmethode in irgendeiner Weise mehrere Zellen umfasst, den Effekt die durchschnittliche Länge nimmt zu, während tatsächlich etwas anderes passiert ist. Daraus ergaben alle diese Studien, dass die Telomerlänge zugenommen hat.


Ein Telomer kann mit einem Flow-Fish-Test gemessen werden. Grundsätzlich werden fluoreszierende Marker, die DNA binden, in den Zellkern eingeführt, und dann können diese Marker unter Verwendung einer Methode namens Durchflusszytometrie gezählt werden.

Es kann auf einer Zelle durchgeführt werden

Ich bin mir nicht sicher, ob ich den letzten Teil der Frage verstehe, aber ich kann sagen, dass, wenn die durchschnittliche Telemore-Größe in einer bestimmten Stichprobengröße zunimmt, Wissenschaftler auf der Grundlage dieser Daten keine Schlüsse ziehen werden.

Wenn es eine wissenschaftliche Schlussfolgerung über die Telomergröße im Verhältnis zum externen Selektionsdruck gibt, gäbe es statistisch signifikante Daten, die die in verschiedenen Zellen beobachteten Variationen richtig erklären.


Eine quantitative PCR-Methode zur Messung der absoluten Telomerlänge

Wir beschreiben eine einfache und reproduzierbare Methode zur Messung der absoluten Telomerlänge (aTL) mit quantitativer Echtzeit-Polymerase-Kettenreaktion (qPCR). Dieses Verfahren basiert auf dem Cawthon-Verfahren zur relativen Messung der Telomerlänge (TL), jedoch modifiziert durch Einführung eines Oligomer-Standards zur Messung von aTL. Die Methode beschreibt die Oligomerstandards, die Erstellung der Standardkurve und die Berechnungen, die zur Berechnung von aTL aus den qPCR-Daten erforderlich sind. Die notwendigen Kontrollen und Leistungsmerkmale des Assays werden detailliert beschrieben und mit anderen Methoden zur Messung von TL verglichen. Es werden typische Ergebnisse für diesen Assay für eine Vielzahl von menschlichen Gewebeproben sowie ein Zeitplan zur Fehlerbehebung bereitgestellt. Dieses Verfahren ermöglicht die Messung von aTL mit hohem Durchsatz unter Verwendung kleiner DNA-Mengen, wodurch es für molekularepidemiologische Studien geeignet ist. Im Vergleich zu den traditionellen relativen TL-qPCR-Assays ermöglicht die in diesem Protokoll beschriebene aTL-Methode einen direkteren Vergleich der Ergebnisse zwischen Experimenten innerhalb und zwischen Labors.


Hintergrund

Es wird allgemein angenommen, dass Frauen längere Telomere haben als Männer, obwohl die Ergebnisse von Studien widersprüchlich waren.

Methoden

Wir haben eine systematische Übersicht und Metaanalysen durchgeführt, um die Hypothese zu überprüfen, dass Frauen beim Menschen längere Telomere haben als Männer und dass dieser Zusammenhang mit zunehmendem Alter stärker wird. Recherchen wurden in EMBASE und MEDLINE (bis November 2009) durchgeführt und zusätzliche Datensätze wurden von den Studienprüfern eingeholt. Berechtigte Beobachtungsstudien maßen Telomere sowohl bei Frauen als auch bei Männern jeden Alters, hatten eine Mindeststichprobengröße von 100 und schlossen Teilnehmer ein, die nicht zu einer erkrankten Gruppe gehörten. Wir berechneten zusammenfassende Schätzungen unter Verwendung von Random-Effects-Metaanalysen. Die Heterogenität zwischen den Studien wurde mittels Subgruppenanalyse und Meta-Regression untersucht.

Ergebnisse

Metaanalysen von 36 Kohorten (36.230 Teilnehmer) zeigten, dass Frauen im Durchschnitt längere Telomere hatten als Männer (standardisierter Unterschied der Telomerlänge zwischen Frauen und Männern 0,090, 95 % CI 0,015, 0,166 altersbereinigt). Es gab wenig Hinweise darauf, dass diese Assoziationen je nach Altersgruppe (p = 1,00) oder Zelltyp (p = 0,29) variierten. Die Größe dieses Unterschieds variierte jedoch je nach Messmethode, wobei nur Southern-Blot, aber weder Real-Time-PCR noch Flow-FISH einen signifikanten Unterschied zeigten. Dieser Unterschied war nicht mit einem zufälligen Messfehler verbunden.

Schlussfolgerungen

Die Telomerlänge ist bei Frauen länger als bei Männern, obwohl dieser Unterschied in Studien, die keine Southern-Blot-Methoden verwendeten, nicht allgemein gefunden wurde. Weitere Forschungen zur Erklärung der methodischen Unterschiede sind erforderlich.


Telomere im Stress

Telomere schützen die Integrität der Chromosomen. Sie werden in den meisten Zellen mit jeder Zellteilung kürzer, da die Telomerase in den allermeisten menschlichen Zellen nicht aktiv ist [10]. Man könnte sagen, sie „opfern“ sich selbst. Zumal der Verlust einer Telomersequenz für den aktuellen Stoffwechselzustand einer Zelle nicht so kritisch ist wie der Verlust der DNA-Sequenz für ein Protein als DNA-Doppelstrangbrüche erkannt, die wiederum DNA-Reparaturmechanismen alarmieren würden [11]. Mit der Zeit nimmt die Telomerlänge in normalen Zellen jedoch ab, bis sie zu kurz werden, um ihre Rolle zu spielen und die Zellen teilungsfähig zu halten führt zu einer zellulären Seneszenz, die eine der Hauptursachen für Altern und altersbedingte Störungen ist [12], die mit dem Endreplikationsproblem (Hayflick-Limit) [13] verbunden sind.

Die Expression und Aktivität der Telomerase in menschlichen Zellen nimmt mit dem Alter ab [14]. Es ist jedoch ein individuelles Phänomen und die Telomerabnutzungsrate wird unter anderem mit der Fähigkeit zur Stressbewältigung in Verbindung gebracht. Wie vorgeschlagen, ist körperliche Aktivität (die als eine der wichtigsten Möglichkeiten zur Verringerung des Stressniveaus wahrgenommen wird) mit einem gesunden Altern und einem verringerten Risiko für mehrere chronische Erkrankungen, möglicherweise aufgrund der Wiederherstellung der Telomere, verbunden [15, 16]. Auf zellulärer Ebene bezeichnet Stress die Faktoren, die den Stoffwechsel beeinflussen oder die Zelle schädigen können. Unabhängig von der Intensität häuft sich jedoch mit zunehmendem Alter Stress an und kann sich negativ auf die Gesundheit und das Wohlbefinden des Einzelnen auswirken. Wichtig ist, dass Antioxidantien den Beginn der vaskulären Seneszenz auf Telomerase-abhängige Weise verzögern. In einer In-vitro-Studie wurde gezeigt, dass die reaktiven Sauerstoffspezies (ROS) den Spiegel des nuklearen hTERT-Proteins (humane Telomerase reverse Transkriptase) (die wichtigste Telomerase-Untereinheit) und die Telomerase-Aktivität in Endothelzellen verringern, worauf eine seneszente Phänotypentwicklung folgte . Gleichzeitig blockierte die Inkubation mit dem Antioxidans N-Acetylcystein diesen nukleären Export von hTERT in das Zytosol, was auf seine Rolle bei der Stressreaktion schließen lässt [17]. Es wurde gezeigt, dass ein weiteres bekanntes Antioxidans – a-Tocopherol – die Telomerverkürzung unterdrückt und die Telomerase-Aktivität in mikrovaskulären Endotheliozyten des Gehirns beibehält [18]. In ähnlicher Weise wurde gezeigt, dass Ginko Biloba-Extrakt (mit hohem antioxidativem Potenzial) den Beginn der Seneszenz durch die Aktivierung der Telomerase über den PI3k/Akt-Signalweg verzögert [19, 20]. Wichtig ist, dass chronischer Stress zu einer erhöhten Sekretion von Cortisol führt, das in der Lage ist, die Telomerase-Aktivierung im Immunsystem zu unterdrücken und folglich den Telomerabrieb zu fördern [21].

Tatsache ist, dass das Altern mit einem Telomerabrieb einhergeht, obwohl seine Rate zwischen Individuen, verschiedenen Zelltypen, aber auch verschiedenen Chromosomen sehr heterogen ist [22]. Gerade der neueste Aspekt lässt den Schluss zu, dass Zellen vorzeitig altern können, selbst wenn die durchschnittliche Telomerlänge "normal" ist, aber einige spezifische Chromosomenenden kritisch kurz sind. Da Altern, Stressreaktion und Telomerabnutzung einige biochemische Wege gemeinsam sind, glauben wir, dass Chromosomenenden sehr empfindliche Stressmarker und zuverlässige Indikatoren für die Zellalterung sind. Es scheint jedoch, dass die einzige Möglichkeit, die Telomerlänge als Marker für Seneszenz/Alterung/Stress-Exposition anzuerkennen, darin besteht, die Länge/Abnutzungsrate einzelner einzelner Chromosomen zu beurteilen und nicht die durchschnittliche Gesamtlänge der Telomere zu messen.

Ein weiterer wichtiger Bericht wurde von Garrett-Bakelman et al. demonstriert, die eine Studie im Zusammenhang mit der Exposition gegenüber verringerter Schwerkraft demonstrierten. Wie gezeigt, erlebte ein Astronaut (Scott Kelly), der fast ein Jahr auf der Internationalen Raumstation verbrachte, einige schwere Syndrome (verminderte Körpermasse, Instabilität seines Genoms, Schwellungen in wichtigen Blutgefäßen, Veränderungen der Augenform, Stoffwechselverschiebungen, Entzündungen). und Veränderungen in seinem Mikrobiom), sondern auch eine signifikante Telomerverlängerung. Wichtig ist, dass sich die Chromosomenenden nach der Landung des Astronauten wieder verkürzten und innerhalb von 6 Monaten nach der Rückkehr zur Erde fast auf das Niveau vor dem Flug zurückkehrten. Es wurde jedoch eine erhöhte Anzahl von kurzen Telomeren beobachtet, und die Expression einiger Gene war immer noch gestört. Gleichzeitig wurde sein eineiiger Zwillingsbruder (der die Zeit nicht im Weltraum verbrachte) als Referenz überwacht, der keine signifikanten Veränderungen der Telomerlänge zeigte [23]. Dieser Fall zeigt, wie komplex die Telomerregulation ist.


Methoden

Themen und Kontrollen

Lungengesundheitsstudie (LHS). Die Studie verwendete klinische Daten und biologisches Material, das im Rahmen der Lung Health Study (LHS) gewonnen wurde, einer vom National Heart, Lung and Blood Institute gesponserten klinischen Studie. Nach Erhalt der schriftlichen Einwilligungserklärung nahm der LHS zunächst 5887 Raucher im Alter von 35� Jahren mit leichter bis mittelschwerer Atemwegsbeschränkung (definiert als Verhältnis des forcierten Exspirationsvolumens in einer Sekunde (FEV .)1) zur erzwungenen Vitalkapazität (FVC)≤.70 und 55㳾V1㲐% vorhergesagt) in 10 Zentren in Nordamerika [15]. Personen mit Krebs in der Vorgeschichte (außer Carcinoma in situ oder Basalzellkarzinom der Haut), Myokardinfarkt (in den letzten zwei Jahren), Angina pectoris, Herzinsuffizienz, Schlaganfall (in den letzten zwei Jahren), Nierenversagen, Insulin- Diabetes mellitus, Zirrhose oder andere schwere Lebererkrankungen, Lungenembolie, Erkrankungen des Zentralnervensystems, Engwinkelglaukom oder andere schwerwiegende Erkrankungen, die die Nachsorge beeinträchtigen könnten, wurden ausgeschlossen [16].

Während der ersten 5 Jahre der Nachbeobachtung wurden die Lungenfunktion und der Raucherstatus der Teilnehmer jährlich beurteilt. Teilnehmer wurden als anhaltende Raucher kategorisiert, wenn sie bei jedem jährlichen Besuch validierte Nichtraucher waren. Teilnehmer, die bei jedem jährlichen Besuch rauchten, waren weiterhin Raucher. Diejenigen, deren Rauchverhalten variierte, wurden als intermittierende Raucher eingestuft. In Jahr 5 lieferten 4.803 Teilnehmer Blutproben (das entspricht 89% der berechtigten Teilnehmer). Die Blutproben wurden in ihre Bestandteile zerlegt und bis zur Verwendung in �ଌ Gefrierschränken gelagert. Die Studienteilnehmer wurden dann bis Ende 2001 für eine mediane Nachbeobachtungszeit von 7,5 Jahren vom Zeitpunkt der Venenpunktion bis zum Studienabschluss passiv nachbeobachtet. Während des Follow-up wurden der Vitalstatus und die Krankenhausaufenthalte der Teilnehmer aufgezeichnet. Ein Mortalitäts- und Morbiditätsausschuss überprüfte alle Patientenakten, einschließlich Sterbeurkunden, Augenzeugenberichte, Nekropsieakten, Zusammenfassungen von Interviews mit behandelnden Ärzten und Krankenhausaufenthaltsakten und ordnete der Mortalität aller Verstorbenen eine Ursache zu. Diese Daten wurden durch einen National Death Index ergänzt, der das Todesdatum und die Todesursache aller US-Studienteilnehmer angab [16]. Die Endpunkte der Sterblichkeit wurden in folgende Gruppen eingeteilt: koronare Herzkrankheit, kardiovaskuläre Erkrankung (einschließlich koronare Herzkrankheit), Lungenkrebs, alle Krebsarten (einschließlich Lungenkrebs), Atemwegserkrankungen außer Lungenkrebs, andere und unbekannt.

Studienkohorte für gesundes Altern. Um die Telomerlängen von COPD-Patienten in LHS mit einer Kontrollgruppe ohne COPD zu vergleichen, verwendeten wir Telomerdaten von Patienten mittleren Alters aus der Healthy Aging Study, die zwischen 40 und 50 Jahre alt waren und ohne Rücksicht auf ihre Gesundheit zufällig rekrutiert wurden oder Krankheitsstatus (dh “negative” Kontrollen) [17].

Advair, Biomarker in der COPD (ABC) Kohorte. Als zweite Kontrollgruppe (d. h. “positive” Kontrollen) haben wir die Telomerlänge peripherer Leukozyten von Patienten mit mittelschwerer bis schwerer COPD gemessen, wie sie spirometrisch durch FEV . definiert wurde1/FVC-Verhältnis kleiner als 70% und FEV1 weniger als 80% der prognostizierten, die eine Raucheranamnese von mindestens 10 Packungsjahren hatten und mindestens 40 Jahre alt waren [18]. Die Ergebnisse dieser Studie wurden bereits veröffentlicht [13].

Leukozyten-DNA-Extraktion

Die Konzentration von DNA aus peripherem Blut, das im Jahr 5 gesammelt wurde, wurde unter Verwendung eines NanoDrop 8000-Spektrophotometers (Thermo Scientific, Wilmington, USA) bestimmt. Die DNA-Proben wurden auf 1 ng/µL in 1× Tris-EDTA-Puffer verdünnt und bei �ଌ für die anschließende Verwendung in der quantitativen Polymerase-Kettenreaktion (qPCR) gelagert.

Messung der Telomerlänge

Periphere Blut-Leukozyten-Telomere wurden unter Verwendung eines modifizierten qPCR-Protokolls gemessen, das von Cawthon [19] beschrieben wurde. Die Primersequenzen (geschrieben 5′𡤣′) waren: tel 1, GGTTTTTGAG -GGTGAGGGTGAGGGTGAGGGTGAGGGGT tel 2, TCCCGACTATCCCTATCCCTATCCC -TATCCCTATCCCTA 36B4u, CAGCAAGTGGGAAGGTGTAATCC 36B4d, CCCATTCTA -TCATCAACGGGTACAA. Das verwendete Referenz-Einzelkopiegen war 36B4 und die Endkonzentrationen der Primer (Sigma, The Woodlands, TX) waren tel 1, 270 nM tel 2, 900 nM, 36B4u, 300 nM 36B4d, 500 nM.

Die Messung der Telomerlänge wurde dreifach für alle Proben in einer klaren optischen Reaktionsplatte mit 384 Vertiefungen (Applied Biosystems, Foster City, CA) durchgeführt. Referenz-DNA, die vom Coriell Institute (Camden, NJ) erhalten wurde, wurde dreifach auf jeder PCR-Platte getestet, um die Messabweichung zwischen den Platten zu berücksichtigen. Jede Vertiefung enthielt 10 µL QuantiTect SYBR Green PCR Master Mix (QIAGEN, Mississauga, ON) und eine DNA-Endkonzentration von 0,25 ng/µL. Nach dem Beladen wurden die Platten mit MicroAmp Optical Adhesive Film (Applied Biosystems, Foster City, CA) versiegelt und kurz bei 2.500 U/min zentrifugiert. Die Reaktionen wurden in einem ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City CA) durchgeführt. Das thermische Zyklenprofil sowohl für die Telomer- als auch für die Single-Copy-Gen-Amplifikation begann mit 50ଌ für 2 min und dann 95ଌ für 2 min. Für die Telomer-PCR folgten 30 Zyklen mit 95ଌ für 15 s und 54ଌ für 2 min. Dem 36B4-Zyklusprofil folgten 35 Zyklen mit 95ଌ für 15 s und 58ଌ für 1 Minute. Die Telomerlänge wurde als relatives T/S-Verhältnis (T = telomer, S = single copy gene) quantifiziert, berechnet nach der Formel von Cawthon [19].

Statistische Analyse

Die Telomerlängen von peripheren Blutleukozyten wurden auf das Referenz-Einzelkopie-Gen (T/S) standardisiert. Zu analytischen Zwecken wurden die Teilnehmer anhand ihres T/S-Verhältnisses in Quartile eingeteilt. Die klinischen Merkmale wurden dann mit einem Chi-Quadrat-Test für dichotome Variablen (mit entsprechenden Freiheitsgraden) und einem Cochran-Armitage-Test für den Trend für kontinuierliche Variablen verglichen. Der primäre Endpunkt dieser Studie war die Gesamtmortalität. Wir verglichen das Risiko der Gesamtmortalität über die Quartile während des Nachbeobachtungszeitraums unter Verwendung einer Kaplan-Meier (K-M)-Methode für die univariate Analyse und eines Cox-Proportional-Hazards-Modells für die multivariate Analyse. Die KM-Überlebenskurven über die T/S-Quartile wurden unter Verwendung eines Log-Rank-Tests verglichen. In das multivariate Modell schlossen wir die folgenden Kovariaten ein: Alter, Geschlecht, Body-Mass-Index (BMI), Raucherstatus während der ersten 5 Jahre der Nachbeobachtung, Packungsjahre des Rauchens, Blutdruck in Jahr 5 und FEV1 im Jahr 5. FEV1, BMI, Blutdruckmessungen und Packungsjahre des Rauchens hatten keinen signifikanten Einfluss auf die Ergebnisse des Modells. Somit wurden sie im Endeffekt fallen gelassen. Ein ähnlicher Ansatz wurde für ursachenspezifische Mortalitätsendpunkte verwendet. Die T/S-Verhältnisse der Rauchergruppen wurden mit dem Kruskal-Wallis-Test verglichen, da die Daten nicht normalverteilt waren. Korrelationen zwischen dem T/S-Verhältnis und Variablen wie FEV1 im Alter von 5 Jahren wurden mit dem Spearman-Test auf nicht-parametrische Variablen getestet. P-Werte von weniger als 0,05 (bei Verwendung eines zweiseitigen Tests) wurden als signifikant angesehen. Alle Analysen wurden mit SAS (Version 9.1, Carey, N.C.) durchgeführt. Die Verwendung von LHS- und ABC-Studienproben wurde vom Providence Health Care/UBC Research Ethics Board genehmigt. Die Verwendung von Proben aus der Healthy-Aging-Studie wurde vom gemeinsamen Clinical Research Ethics Board der UBC und der British Columbia Cancer Agency genehmigt.


Ergebnisse

Deskriptive Statistiken und Gruppenunterschiede zwischen den Studienvariablen sind in Tabelle 1 dargestellt. Bivariate Korrelationen sind in Tabelle 2 dargestellt. Wie in diesen Tabellen gezeigt, gab es Gruppenunterschiede in Geburtsgewicht und IQ. Auch Geburtsgewicht, IQ und Geschlecht wurden unterschiedlich mit Psychopathologie in Verbindung gebracht. Daher führten wir erneut separate Pfadmodelle mit jeweils Geschlecht, IQ und Geburtsgewicht als Kovariaten durch und die Ergebnisse unterschieden sich nicht wesentlich. Wie aus Tabelle 1 ersichtlich, gab es zu keinem Zeitpunkt einen direkten Zusammenhang zwischen der Telomerlänge und dem Gruppenstatus – entweder beim Vergleich von NIG mit EIG oder FCG mit CAUG. Wie in Tabelle 2 zu sehen ist, gab es bei TL im Laufe der Zeit eine Stabilität der Rangordnung, was bedeutet, dass Personen mit kürzeren Telomeren im Alter von 8� tendenziell kürzere Telomere im Alter von 12� hatten als Personen mit längeren Telomeren. Darüber hinaus gab es in Übereinstimmung mit früheren Studien eine Verkürzung der Telomere im Laufe der Zeit in der gesamten Probe, T (df ​​= 76) = 3,01, P = .004.

Tabelle 1:

Merkmale und deskriptive Statistiken unter institutionalisierten und nie institutionalisierten Kindern

Alter 8� Maßnahmen
Alle TeilnehmerNur institutionalisierte Kinder
EIG (n= 96)NIG (n= 99)T oder χ 2 CAUG (n= 44)FCG (n= 52)T oder χ 2
Geschlecht männlich)52.1%48.5%.2552.351.9.001
Geburtsgewicht (g)2755.23208.05.06 *** 2847.52675.01.33
Voller IQ80.2100.29.30 *** 78.281.91.29
Allgemeiner Faktor.45−.446.84 *** .51.40.57
Internalisierungsfaktor.04−.04.63.12−.02.69
Externalisierender Faktor.00.00.06.06−.04.44
Telomerlänge1.601.59.061.531.65.74
Alter 12� Maßnahmen
Alle TeilnehmerNur institutionalisierte Kinder
EIG (n= 112)NIG (n= 50)T oder χ 2 CAUG (n= 56)FCG (n= 56)T oder χ 2
Geschlecht männlich)51.846.0.4651.851.8<.001
Geburtsgewicht (g)2799.53244.94.29 *** 2878.62722.01.31
Voller IQ72.398.19.00 *** 68.675.82.19 *
Allgemeiner Faktor.20−.444.29 *** .34.061.52
Internalisierungsfaktor−.05.111.22−.01−.09.58
Externalisierender Faktor.16−.374.44 *** .23.10.63
Telomerlänge1.401.43.641.381.41.59

Hinweis: Alle Statistiken sind Mittelwerte außer Geschlecht (%). Allgemeine, internalisierende und externalisierende Variablen sind Faktorwerte mit einem Gesamtstichprobenmittelwert von Null.

Der IQ wurde mit dem WISC-IV bestimmt. Das Geburtsgewicht wird in Gramm gemessen. Die Werte für die Telomerlänge sind in dieser Tabelle nicht angepasst.

Tabelle 2:

Bivariate Korrelationen zwischen Studienvariablen und anderen Merkmalen des Kindes

1.2.3.4.5.6.7.8.9.10.11.
1. Allgemeiner Faktor (Alter 8�)
2. Internalisierungsfaktor (Alter 8�).00
3. Externalisierender Faktor (Alter 8�).00.02
4. Telomerlänge (Alter 8�)−.02−.19 § .03
5. Allgemeiner Faktor (Alter 12�).29 ** .00−.09.18
6. Internalisierungsfaktor (Alter 12�)−.23 ** .12.04.03.15 §
7. Externalisierender Faktor (Alter 12�).37 *** −.04.06−.02.04−.25 **
8. Telomerlänge (Alter 12�)−.05−.25 ** .08.35 ** −.22 ** −.05−.01
9. Geschlecht (männlich).15 * −.07−.05.01.16 * .01.24 ** −.01
10. Geburtsgewicht−.23 ** −.09.23 ** .01−.22 ** −.13−.11−.16 § .09
11. FSIQ (Alter 8�)−.54 *** −.10.05.04−.08.34 ***
12. FSIQ (Alter 12�)−.31 *** .12−.32 *** .02−.08.29 ** .90 ***

Angesichts früherer Ergebnisse zu geschlechtsspezifischen Beziehungen zwischen der Dauer der Heimpflege und der Telomerlänge präsentieren wir Korrelationen zwischen der Verweildauer in Einrichtungen bei EIG (Prozentsatz des Lebens bis zu einem bestimmten Alter) und der Telomerlänge für Männer und Frauen Teilnehmer in Tabelle S1, online verfügbar. Eine längere Dauer der institutionellen Pflege im Alter von 54 Monaten und 8 Jahren war bei männlichen Teilnehmern mit einer kürzeren Telomerlänge im Alter von 8 Jahren verbunden. Bei weiblichen Teilnehmern war eine längere Dauer der Heimpflege zu Studienbeginn und 54 Monate mit einer kürzeren Telomerlänge im Alter von 12 Jahren verbunden. Die im Zeitverlauf in Einrichtungen verbrachte Zeit wurde korreliert (Tabelle S2, online verfügbar). Wenn die Dauer der institutionellen Pflege und die Telomerlänge innerhalb von FCG und CAUG (unter Berücksichtigung des Geschlechts) untersucht wurden, war eine größere Exposition gegenüber der institutionellen Pflege nach 54 Monaten, 8 Jahren und 12 Jahren bei den CAUG mit einer kürzeren Telomerlänge im Alter von 12 Jahren verbunden, aber nicht FCG (Tabelle S3, online verfügbar). Geschlechtsunterschiede wurden innerhalb der FCG- und CAUG-Gruppen aufgrund von Leistungsbeschränkungen nicht untersucht. Wir erweitern diese Ergebnisse in Ergänzung 1. Daher gibt es Assoziationen zwischen der Dauer der Institutionalisierung und der Telomerlänge, die je nach Geschlecht und Alter der Beurteilung variieren, anstatt direkte Assoziationen zwischen Institutionalisierungsgruppe und Telomerlänge. Der starke Zusammenhang zwischen Institutionalisierungsstatus (NIG = 0 EIG = 1) und Psychopathologie rechtfertigt seine Einbeziehung als Kovariate in das unten skizzierte Primärmodell.

Zusammenhang zwischen Telomerlänge und Psychopathologie

Das Längspfadmodell, das die Beziehung zwischen der Telomerlänge und den allgemeinen, internalisierenden und externalisierenden Faktoren beschreibt, ist in Abbildung 1 dargestellt. Die Modellanpassung war akzeptabel: RMSEA = .069 [.02, .11], PCLOSE = .22, CFI = .90 und SRMR = .05. EIG-Kinder hatten im Alter von 8 � eine signifikant höhere allgemeine Psychopathologie als NIG-Kinder, jedoch stand nach Berücksichtigung des allgemeinen Faktors der Institutionalisierungsstatus in keinem Zusammenhang mit Internalisierung oder Externalisierung im Alter von 8�. Darüber hinaus gab es eine relative Stabilität der allgemeinen Psychopathologie im Zeitverlauf unabhängig vom institutionellen Status, aber wenig Stabilität bei der Internalisierung oder Externalisierung, nachdem die Stabilität des allgemeinen Faktors berücksichtigt wurde.

Notiz. Parameter sind standardisiert β Koeffizienten. Psychopathologische Faktoren sind Faktorwerte, die aus dem latenten Bifaktormodell gespeichert und als manifeste Variablen verwendet werden. Es werden nur Beziehungen zwischen Telomerlänge und Psychopathologie gezeigt. Siehe Tabelle 1 für Assoziationen zwischen Psychopathologie-Faktor-Scores. EIG = immer institutionalisierte Gruppe NIG = nie institutionalisiert.

Bezüglich innerhalb der Zeit Assoziationen war eine kürzere Telomerlänge im Alter von 8� signifikant mit höheren internalisierenden Problemen verbunden, aber nicht mit einer allgemeinen oder externalisierenden Psychopathologie verbunden. Andererseits war eine kürzere Telomerlänge im Alter von 12 Jahren mit einer höheren allgemeinen, aber nicht internalisierenden oder externalisierenden Psychopathologie verbunden. Schließlich, über die Zeit hinweg Effekte (d. h. Cross-Lagged-Assoziationen) zeigten, dass eine stärker internalisierende Psychopathologie im Alter von 8 � eine kürzere Telomerlänge im Alter von 12� vorhersagte, nachdem die Telomerlänge im Alter von 8� kontrolliert wurde. Dieser Effekt kann als eine stärker internalisierende Psychopathologie interpretiert werden, die eine Änderung der Telomerlänge vom 8. Lebensjahr zum 12. Lebensjahr vorhersagt. Weder eine allgemeine noch eine externalisierende Psychopathologie im Alter von 8 � waren mit der Telomerlänge im Alter von 12 � verbunden, und es traten keine wechselseitigen Effekte der Telomerlänge auf die Psychopathologie auf. Alle Effekte wurden gleichzeitig und abhängig von allen anderen Effekten im Modell getestet. Da es sich nicht um unabhängige Tests handelte, war keine Korrektur für Mehrfachtests erforderlich.

Schließlich untersuchten wir in Übereinstimmung mit der ursprünglichen Absicht der RCT, ob sich die Assoziationen zwischen den psychopathologischen Faktoren und der Telomerlänge unterschieden zwischen: (i) EIG und NIG und (ii) CAUG und FCG. Das letztere Modell bot eine schlechte Anpassung an die Daten, wahrscheinlich aufgrund einer unzureichenden Power angesichts der geringen Stichprobengröße der CAUG- und FCG-Gruppen. Die Ergebnisse des früheren Modells sind in Supplement 1 enthalten, das online verfügbar ist. Da es keine beobachtbaren Unterschiede in den Verbindungspfaden zwischen Psychopathologie und Telomerlänge zwischen EIG- und NIG-Kindern gab, brach das obige Primärmodell bei allen Kindern zusammen.


Danksagung

Diese Übersicht ist das Ergebnis von Diskussionen und Kooperationen, die aus einem Workshop zur Telomerdynamik in Nicht-Modellorganismen hervorgegangen sind. Der Workshop wurde durch einen BBSRC International Workshop Grant und zusätzliche Unterstützung durch die Genetics Society und Agilent Technologies sowie durch einen Advanced Investigator Award des European Research Council an PM unterstützt. Wir danken allen Teilnehmern des Workshops für ihren Beitrag zu unseren Diskussionen über Telomer-Messmethoden und Abraham Aviv, Hannah Froy und Francois Criscuolo für ihre Kommentare zu Manuskriptentwürfen. DHN wird von einem BBSRC David Phillips Fellowship unterstützt.

Dateiname Beschreibung
mee312161-sup-0001-TableS1.docxWord-Dokument, 16,1 KB Tabelle S1. Liste der Arten- und Gewebelagerungs- und DNA-Extraktionsmethoden und deren Eignung für eine anschließende Telomerlängenanalyse, basierend auf früheren Erfahrungen der Autoren und persönlicher Kommunikation mit Kollegen. AE und TE beziehen sich auf häufig verwendete Pufferlösungen: AE ist eine Mischung aus Natriumacetat und EDTA, TE aus Tris-Lösung und EDTA.

Bitte beachten Sie: Der Herausgeber ist nicht verantwortlich für den Inhalt oder die Funktionalität der von den Autoren bereitgestellten unterstützenden Informationen. Alle Anfragen (außer fehlenden Inhalten) sollten an den entsprechenden Autor des Artikels gerichtet werden.


Elektronisches Zusatzmaterial ist online unter https://doi.org/10.6084/m9.figshare.c.5001038 verfügbar.

Veröffentlicht von der Royal Society unter den Bedingungen der Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, die eine uneingeschränkte Nutzung gestattet, sofern der ursprüngliche Autor und die Quelle angegeben werden.

Verweise

. 2006 Verbindet die Telomerdynamik Lifestyle und Lebensdauer? Trends Öko. Entwicklung 21, 47-53. (doi:10.1016/j.tree.2005.11.007) Crossref, PubMed, ISI, Google Scholar

. 2010 Telomere und Lebensgeschichten: die lange und die kurze . Ann. NY Akad. Wissenschaft 1206, 130-142. (doi:10.1111/j.1749-6632.2010.05705.x) Crossref, PubMed, ISI, Google Scholar

Haussmann MF, Marchetto NM

. 2010 Telomere: Verbindung von Stress und Überleben, Ökologie und Evolution . Cur. Zool. 56, 714-727. (doi:10.1093/czoolo/56.6.714) Crossref, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CF

. 2018 Evolutionäre Ökologie von Telomeren: ein Rückblick . Ann. NY Akad. Wissenschaft 1422, 5-28. (doi: 10.1111/nyas.13443) Crossref, PubMed, ISI, Google Scholar

Olsson M, Wapstra E, Friesen CR

. 2018 Ektothermische Telomere: Es ist Zeit, dass sie aus der Kälte kommen . Phil. Übers. R. Soc. B 373, 20160449. (doi: 10.1098/rstb.2016.0449) Link, ISI, Google Scholar

Gomes N, Shay JW, Wright WE

. 2010 Telomerbiologie in Metazoen. FEBS Lett. 584, 3741-3751. (doi:10.1016/j.febslet.2010.07.031) Crossref, PubMed, ISI, Google Scholar

. 2015 DNA-Exzisionsreparatur an Telomeren. DNA-Reparatur 36, 137-145. (doi:10.1016/j.dnarep.2015.09.017) Crossref, PubMed, ISI, Google Scholar

. 2018 DNA-Schädigung, Reparatur und Erhaltung der Telomerlänge: Rolle von Nahrungsergänzungsmitteln . In Mutagenität: Assays und Anwendungen (Hrsg.)

Kumar A, Dobrovolsky VN, Dhawan A, Shanker R

), S. 287-307. Amsterdam, Niederlande: Elsevier. Google Scholar

2017 Krebsprävalenz und -ätiologie bei Wildtieren und in Gefangenschaft gehaltenen Tieren . In Ökologie und Evolution von Krebs (Hrsg.)

Ujvari B, Roche B, Thomas F

), S. 11-46. London, Großbritannien: Akademische Presse. Crossref, Google Scholar

. 2009 Telomere und Krankheiten. EMBO J. 28, 2532-2540. (doi:10.1038/emboj.2009.172) Crossref, PubMed, ISI, Google Scholar

. 2012 Die Telomersyndrome . Nat. Rev. Genet. 13, 693-704. (doi:10.1038/nrg3436) Crossref, PubMed, ISI, Google Scholar

Stone RC, Horvath K, Kark JD, Susser E, Tishkoff SA, Aviv A

. 2016 Telomerlänge und der Kompromiss zwischen Krebs und Atherosklerose . PLoS Genet. 12, e1006144. (doi:10.1371/journal.pgen.1006144) Crossref, PubMed, ISI, Google Scholar

Barrett ELB, Richardson DS

. 2011 Geschlechtsunterschiede bei Telomeren und Lebensdauer . Alternde Zelle 10, 913-921. (doi:10.1111/j.1474-9726.2011.00741.x) Crossref, PubMed, ISI, Google Scholar

2014 Geschlecht und Telomerlänge: systematische Übersicht und Metaanalyse . Erw. Gerontol. 51, 15-27. (doi:10.1016/j.exger.2013.12.004) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Giraudeau M, Wilson M, Olsson M

. 2017 Telomerdynamik bei einer Eidechse mit morphspezifischer Fortpflanzungsanlage und Selbsterhaltung . Öko. Entwicklung 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Asghar M, Palinauskas V, Zaghdoudi-Allan N, Valkiunas G, Mukhin A, Platonova E, Farnert A, Bensch S, Hasselquist D

. 2016 Parallele Telomerverkürzung in mehreren Körpergeweben aufgrund einer Malariainfektion . Proz. R. Soc. Lange. Biol. Wissenschaft 283, 20161184. (doi:10.1098/rspb.2016.1184) Link, ISI, Google Scholar

Rollings N, Friesen CR, Whittington CM, Johansson R, Shine R, Olsson M

. 2019 Geschlechts- und gewebespezifische Unterschiede der Telomerlänge bei einem Reptil . Öko. Entwicklung 9, 6211-6219. (doi:10.1002/ece3.5164) PubMed, ISI, Google Scholar

Benetos A, Kimura M, Labat C, Buchoff GM, Huber S, Labat L, Lu XB, Aviv A

. 2011 Ein Modell der Telomerdynamik von Hundeleukozyten. Alternde Zelle 10, 991-995. (doi:10.1111/j.1474-9726.2011.00744.x) Crossref, PubMed, ISI, Google Scholar

Daniali L, Benetos A, Susser E, Kark JD, Labat C, Kimura M, Desai K, Granick M, Aviv A

. 2013 Telomere verkürzen sich im Körpergewebe von Erwachsenen mit vergleichbarer Geschwindigkeit. Nat. Komm. 4, 1597. (doi:10.1038/ncomms2602) Crossref, PubMed, ISI, Google Scholar

Reichert S, Criscuolo F, Verinaud E, Zahn S, Massemin S

. 2013 Korrelationen der Telomerlänge zwischen Körpergeweben bei erwachsenen Zebrafinken . Plus eins 8, e81496. (doi:10.1371/journal.pone.0081496) Crossref, PubMed, ISI, Google Scholar

. 2004 Hämatologie niederer Wirbeltiere. In 55. Jahrestagung des American College of Veterinary Pathologists (ACVP) und 39. Jahrestagung der American Society of Clinical Pathology (ASVCP) . Middleton, WI: American College of Veterinary Pathologists und American Society for Veterinary Clinical Pathology. Google Scholar

Beaulieu M, Benoit L, Abaga S, Kappeler PM, Charpantier MJE

. 2017 Mind the cell: saisonale Variation der Telomerlänge spiegelt Veränderungen im Leukozytenprofil wider . Mol.-Nr. Öko. 26, 5603-5613. (doi:10/1111/mec.14329) Crossref, PubMed, ISI, Google Scholar

. 2009 Vergleichende Morphologie, Entwicklung und Funktion von Blutzellen bei Nicht-Säuger-Vertebraten . J. Exot. Haustier. Med. 18, 87-97. Crossref, ISI, Google Scholar

. 2019 Physiologie der roten und weißen Blutkörperchen. Anästhe. Intensivmedizin Med. 20, 170-174. (doi:10.1016/j.mpaic.2019.01.001) Crossref, ISI, Google Scholar

. 2002 Oxidativer Stress verkürzt die Telomere. Trends Biochem. Wissenschaft 27, 339-344. (doi:10.1016/S0968-0004(02)02110-2) Crossref, PubMed, ISI, Google Scholar

Baerlocher GM, Lansdorp PM

. 2003 Messung der Telomerlänge in Leukozyten-Untergruppen durch automatisierten mehrfarbigen Flow-FISH. Zytometrie Teil A 55A, 1-6. (doi:10.1002/cyto.a.10064) Crossref, ISI, Google Scholar

Carvalho de MP, Queiroz-Hazarbassanov NG, Massoco CO, Rossi S, Sant'Anna SS, Catão-Dias JL, Grego KF

. 2016 Durchflusszytometrische Charakterisierung von Leukozytenpopulationen im peripheren Blut von 3 neotropischen Schlangenarten: Boa constrictor, Bothrops jararaca, und Crotalus durissus . Tierarzt. Klin. Pathol. 45, 271-280. (doi: 10.1111/vcp.12358) Crossref, PubMed, ISI, Google Scholar

Carvalho de MPN, Queiroz-Hazarbassanov NGT, de Oliveira Massoco C, Sant'Anna SS, Lourenço MM, Levin G, Sogayar MC, Grego KF, Catão-Dias JL

. 2017 Funktionelle Charakterisierung von Untergruppen der peripheren Blutleukozyten von neotropischen Schlangen: Verknüpfung von durchflusszytometrischen Zellmerkmalen, Mikroskopiebildern und Serum-Corticosteron-Spiegeln . Abw. Komp. Immunol. 74, 144-153. (doi:10.1016/j.dci.2017.04.007) Crossref, PubMed, ISI, Google Scholar

Olsson M, Friesen CR, Rollings N, Sudyka J, Lindsay W, Whittington C, Wilson MR

. 2018 Langzeitwirkungen von Superoxid- und DNA-Reparatur auf Eidechsen-Telomere . Mol.-Nr. Öko. 27, 5154-5164. (doi:10.1111/mec.14913) Crossref, PubMed, ISI, Google Scholar

Rollings N, Friesen CR, Sudyka J, Whittington C, Wilson M, Olsson M

. 2017 Telomerdynamik bei einer Eidechse mit morphspezifischer Fortpflanzungsanlage und Selbsterhaltung . Öko. Entwicklung 7, 5163-5169. (doi:10.1002/ece3.2712) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Schwartz T, Lebas N, Uller T

. 2007 Paarungssystemvariation und Morphfluktuationen bei einer polymorphen Eidechse. Mol.-Nr. Öko. 16, 5307-5315. (doi:10.1111/j.1365-294X.2007.03578.x) Crossref, PubMed, ISI, Google Scholar

Olsson M, Healey M, Wapstra E, Uller T

. 2009 Testen der Qualität eines Trägers: ein Feldexperiment zu Echsensignalgebern . Evolution 63, 695-701. (doi:10.1111/j.1558-5646.2008.00569.x) Crossref, PubMed, ISI, Google Scholar

. 2009 Zu groß für seine Stiefel: Sind soziale Kosten bei einer australischen Eidechse ein Signal für den zustandsabhängigen Status, das ehrlich ist? Austral Ecol. 34, 636-640. (doi:10.1111/j.1442-9993.2009.01968.x) Crossref, ISI, Google Scholar

. 2000 Chapter 21: Reptilian complete blood count . In Laboratory medicine: avian and exotic pets (ed.

), pp. 193-197. Philadelphia, PA : W.B. Saunders Company . Google Scholar

Stacy NI, Alleman AR, Sayler KA

. 2011 Diagnostic hematology of reptiles . Klin. Labor. Med. 31, 87-108. (doi:10.1016/j.cll.2010.10.006) Crossref, PubMed, ISI, Google Scholar

. 2008 Hematologic evaluation is mainstay of diagnosis for reptiles . Vet. Tech. 29, 616. Google Scholar

Nazarpour R, Zabihi E, Alijanpour E, Abedian Z, Mehdizadeh H, Rahimi F

. 2012 Optimization of human peripheral blood mononuclear cells (PBMCs) cryopreservation . Int. J.Mol. Zelle. Med. 1, 88-93. PubMed, Google Scholar

. 1991 Structure and function of telomeres . Natur 350, 569-573. (doi: 10.1038/350569a0) Crossref, PubMed, ISI, Google Scholar

Fischer U, Ototake M, Nakanishi T

. 1998 Lifespan of circulating blood cells in ginbuna crucian carp (Carassius auratus langsdorfii) . Fish Shellfish Immunol. 8, 339-349. (doi:10.1006/fsim.1998.0144) Crossref, ISI, Google Scholar

Asghar M, Hasselquist D, Hansson B, Zehtindjiev P, Westerdahl H, Bensch S

. 2015 Hidden costs of infection: chronic malaria accelerates telomere degradation and senescence in wild birds . Wissenschaft 347, 436-438. (doi10.1126/science.1261121) Crossref, PubMed, ISI, Google Scholar

Angelier F, Costantini D, Blévin P, Chastel O

. 2018 Do glucocorticoids mediate the link between environmental conditions and telomere dynamics in wild vertebrates? Eine Rezension . Gen. Komp. Endokrinol. 256, 99-111. (doi:10.1016/j.ygcen.2017.07.007) Crossref, PubMed, ISI, Google Scholar

Kurz DJ, Decary S, Hong Y, Trivier E, Akhmedov A, Erusalimsky JD

. 2004 Chronic oxidative stress compromises telomere integrity and accelerates the onset of senescence in human endothelial cells . J. Cell Sci. 117, 2417-2426. (doi:10.1242/jcs.01097) Crossref, PubMed, ISI, Google Scholar

Fouquerel E, Parikh D, Opresko P

. 2016 DNA damage processing at telomeres: the ends justify the means . DNA-Reparatur 44, 159-168. (doi:10.1016/j.dnarep.2016.05.022) Crossref, PubMed, ISI, Google Scholar

Sardina JL, Lopez-Ruano G, Sanchez-Sanchez B, Llanillo M, Hernandez-Hernandez A


Design and methods

Setting and subjects

This analysis was performed within the framework of the Prevention of Renal and Vascular End-Stage Disease (PREVEND, www.prevend.org) study. The PREVEND study is an ongoing, longitudinal, general, population-based cohort study of individuals aged 28–75 years living in the city of Groningen, the Netherlands. For the present study, we included subjects who donated a full blood sample for DNA extraction at baseline (T1) and/or during the first (T2) and/or the second (T3) follow-up visit. Details of the study have been described previously 15 . In brief, 8592 subjects completed the baseline survey (1997–1998) and were invited to visit the outpatient department after approximately 4.3 years for the first and approximately 6.6 years for the second follow-up visit. At each visit, demographic and anthropometric characteristics and serum biomarkers were assessed. The PREVEND study has been approved by the local medical ethics committee and is being conducted in accordance with the guidelines of the Declaration of Helsinki. All participants provided written informed consent before enrolment.

Measurement of telomere length

Details of the methods of DNA extraction and of telomere length measurements are provided in the Appendix S1. In brief, all samples for DNA collected at different time-points were mixed and randomly extracted using a standard DNA extraction kit (QIamp, Qiagen, Venlo, the Netherlands) to neutralize potential batch effects. Mean relative leukocyte telomere length was measured using a monochrome multiplex real-time quantitative polymerase chain reaction technique (developed by R.M.C.) 16 . This technique enables the telomere-specific amplification and the single copy gene (reference) amplification to be carried out in a single reaction well with quantification measurements at different temperatures 16 . The ratio of telomere (T) to single copy gene (S) content (T/S ratio) is a relative measure of telomere length (RTL) and is expressed in arbitrary units (RTLU). All samples were measured in triplicate, and the average of the three runs was used to provide the mean RTLU for each individual. The intra-assay coefficients of variation were 2.0%, 1.9% and 4.5% for T, S and the T/S ratio, respectively.

We adhered to the arbitrary categorization of telomere trajectories as previously reported: shortening was defined as a >10% decrease in RTL, stable as a ≤10% change in RTL and elongation as a >10% increase in RTL at T3 compared to baseline 17, 18 .

Other measurements and definitions

All participants completed a questionnaire regarding demographic profile and smoking habits. Smoking was categorized as current smoking, previous smoking and nonsmoking. Body mass index (BMI) was calculated as weight (kg) divided by height squared (m 2 ) and categorized as follows: normal, <25 kg m −2 overweight, 25–30 kg m −2 and obese, ≥30 kg m −2 . Hypertension was defined as systolic blood pressure ≥140 mmHg, diastolic blood pressure ≥90 mmHg or the use of antihypertensive medication prehypertension was defined as systolic blood pressure <140 and ≥120 mmHg and diastolic blood pressure <90 and ≥80 mmHg and normotension was defined as both systolic blood pressure <120 mmHg and diastolic blood pressure <80 mmHg. Diabetes was defined as a fasting plasma glucose level of ≥126 mg dL −1 (7.0 mmol L −1 ), a nonfasting plasma glucose level of ≥200 mg dL −1 (11.1 mmol L −1 ) or the use of oral antidiabetic agents. Hypercholesterolaemia was defined as a total cholesterol level of ≥250 mg dL −1 (6.5 mmol L −1 ) or the use of lipid-lowering medication ≤200 mg dL −1 (5.13 mmol L −1 ) was considered an optimal cholesterol concentration. Estimated glomerular filtration rate (eGFR) was calculated using the Modification of Diet in Renal Disease (MDRD) study equation taking into account sex, age, ethnicity and serum creatinine levels 19 . Details of the measurement methods can be found in the Appendix S1.

Statistische Analyse

To obtain a normal distribution, telomere length was natural-log-transformed. Other continuous variables with a skewed distribution (creatinine, insulin, glucose, high-sensitivity C-reactive protein, cholesterol, HDL and triglycerides) were also natural-log-transformed prior to analysis. Individuals in the bottom and top 0.5% of the RTL distribution were excluded to limit the undue influence of outliers in the regression analysis. Differences in telomere lengths between groups were tested using Student's T-test or one-way anova . Cross-sectional associations between variables and telomere length were evaluated using standard linear regression models. Multivariate linear regression models were used to adjust for age and gender. To investigate telomere dynamics across time, two-level hierarchical growth models were constructed. Variables were centred around the grand mean (i.e. the mean was set to zero). Details of the model-building strategy, centring and multitest correction are provided in the Appendix S1.


Schlussfolgerungen

Numerous observational studies of TL have been conducted among breast cancer patients in the last 20 years. Despite the major methodologic differences between studies, when considering all the studies (peripheral blood and tumor tissue) and all outcomes together, there was a trend toward an association of longer telomeres with a better prognosis. Further longitudinal studies with rigorous methodology, including proper control of confounding and an adequate TL measurement method, are still needed to determine the exact prognostic significance of TL for breast cancer patients.