Information

Wie wurde Gen-Knock-out in der Vor-CRISPR-Ära durchgeführt?

Wie wurde Gen-Knock-out in der Vor-CRISPR-Ära durchgeführt?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich versuche zu verstehen, wie CRISPR den Gen-Knockout- oder Gen-Editing-Prozess vereinfacht hat, um transgene Tiere herzustellen. Hier ist ein altes Flussdiagramm (vor CRISPR) von Manis, 2007, das zeigt, wie Knockouts gemacht werden können.

Ich gehe davon aus, dass ein Großteil dieses Prozesses auch bei CRISPR gleich bleibt. Aber ich möchte verstehen, welcher Teil dieses Flussdiagramms mit CRISPR einfacher geworden ist? Müssen wir nicht warten, bis ein zufälliges Rekombinationsereignis eintritt? Liegt es daran, dass der Ertrag gestiegen ist, weil wir direkt vor Ort schneiden und darum bitten, dass HDR stattfindet, anstatt einfach nur darauf zu warten, dass es passiert?


CRISPR/Cas9-vermittelter Knock-out des VPREB1-Gens induziert eine zytotoxische Wirkung in Myelomzellen

Das Multiple Myelom (MM) ist ein heterogenes, hämatologisches Neoplasma, das 2 % aller Krebserkrankungen ausmacht. Obwohl die autologe Stammzelltransplantation und Chemotherapie derzeit die wirksamsten Therapien sind, birgt sie neben ihrer nicht kurativen Wirkung erhebliche Gefahren. Kürzlich wurden die Clustered Regular Interspaced Short Palindromic Repeats (CRISPR-cas9) erfolgreich auf experimenteller Ebene zur Behandlung verschiedener hämatologischer Malignome erprobt.

Ziele

Wir wollten untersuchen, in-vitro Wirkung von CRISPR-cas9-vermitteltem Knock-out der V-Set-Prä-B-Zell-Surrogat-Leichtkette 1”VPREB1”-Gen auf die maligne Proliferation von primär kultivierten Myelomzellen.

Methoden

Die Analyse der Bioinformatik wurde durchgeführt, um das Genexpressionsprofil von MM zu untersuchen VPREB1 Gen wurde als Zielgen für diese Studie ausgewählt. Wir haben das rausgeschmissen VPREB1 Gen in primär kultivierten Myelomzellen mit CRISPR-cas9, dem VPREB1 Die Wirksamkeit der Gen-Editierung wurde durch die Bestimmung VPREB1 Genexpression sowohl auf mRNA- als auch auf Proteinebene durch qPCR bzw. Immunfluoreszenz. Darüber hinaus wurde die zytotoxische Wirkung auf die Proliferation von primären Myelomzellen mit einem Zytotoxizitätsassay bewertet.

Ergebnisse

Es gab eine statistisch signifikante Reduktion von beiden VPREB1 mRNA- und Protein-Expressionsniveaus (p<0,01). Knock-out von VPREB1 Gen in der Myelomzelllinie führte zu einer statistisch signifikanten Verringerung der Myelomzellproliferation.

Abschluss

CRISPR-cas9-vermittelter Knock-out von VPREB1 Gen ist wirksam zur Hemmung der Proliferation von primären Myelomzellen. Dies würde eine Grundlage für eine vielversprechende Therapiestrategie für Patienten mit multiplem Myelom bilden.

Zitat: Khaled M, Moustafa AS, El-Khazragy N, Ahmed MI, Abd Elkhalek MA, El_Salahy EM (2021) CRISPR/Cas9-vermittelter Knock-out des VPREB1-Gens induziert eine zytotoxische Wirkung in Myelomzellen. PLoS ONE 16(1): e0245349. https://doi.org/10.1371/journal.pone.0245349

Editor: Zhi-Yao He, West China Hospital, Sichuan University, CHINA

Empfangen: 20. Juni 2020 Akzeptiert: 22. Dezember 2020 Veröffentlicht: 8. Januar 2021

Urheberrechte ©: © 2021 Khaled et al. Dies ist ein Open-Access-Artikel, der unter den Bedingungen der Creative Commons Attribution License vertrieben wird und die uneingeschränkte Verwendung, Verbreitung und Reproduktion in jedem Medium gestattet, sofern der ursprüngliche Autor und die Quelle angegeben werden.

Datenverfügbarkeit: Alle relevanten Daten befinden sich im Manuskript und in den Begleitinformationen.

Finanzierung: Der/die Autor(en) erhielt(en) keine spezielle Förderung für diese Arbeit.

Konkurrierende Interessen: Die Autoren haben erklärt, dass keine konkurrierenden Interessen bestehen.


Wie wurde Gen-Knock-out in der Vor-CRISPR-Ära durchgeführt? - Biologie

Unser Versprechen an Sie:
Garantierte Produktqualität, kompetente Kundenbetreuung.

Gen-Knockout-Zellliniengenerierung

Als einer der führenden Anbieter im Bereich Genome Editing, CRISPR/Cas9-Plattform CB bietet Kunden den umfassendsten Gen-Knockout-Service. Wir konzentrieren uns auf die Entwicklung der CRISPR-Technologie, um unseren Kunden zufriedene Produkte und Dienstleistungen zu bieten. In Bezug auf führende Plattformen, erfahrene Wissenschaftler und qualifiziertes Personal ist es uns gelungen, Gen-Knockout-Zelllinien in mehreren Spezies wie menschlichen Zellen, Mauszellen, Rattenzellen und Affenzellen zu generieren.

Gen ist eine DNA- oder RNA-Sequenz, die für ein Molekül kodiert, das eine Funktion hat. Ein Chromosom besteht aus einem langen DNA-Strang, der viele Gene enthält. Ein menschliches Chromosom kann beispielsweise bis zu 500 Millionen Basenpaare DNA mit Tausenden von Genen haben. In genetischen Studien werden Gen-Knockout oder Überexpression häufig für Funktionsstudien verwendet. Seit der Entwicklung des CRISPR-Systems ist es einfacher, eine Gen-Knockout-Zelllinie oder ein Modell für die weitere Forschung zu erhalten. Unter Verwendung von CRISPR/Cas9 für den Gen-Knockout wird ein Indel in die Zielorte eingeführt, was zu einer Frame-Shift-Mutation führt. Bei Anwendung auf Gen-Knockout ist sgRNA so konzipiert, dass sie auf die Exons des Gens abzielt. Dann wird Cas9 an die spezifischen Loci rekrutiert und DSB induziert. Indels treten auf, wenn DNA-Doppelstrangbrüche fehleranfällig repariert werden.

CRISPR/Cas9-Plattform CB bietet einen Gen-Knockout-Service für verschiedene Zelllinien an, darunter einfach zu handhabende Zellen, Tumorzellen, Stammzellen und schwer zu handhabende Zellen. Da jeder Fall einzigartig ist, bieten wir zu Beginn eine kostenlose Beratung an. Nach Übermittlung der Informationen zu Gen und Zelllinie erstellen wir einen Plan, um Sie bei Ihren Zielen zu unterstützen.


FDA genehmigt ersten CRISPR-Test zur Korrektur eines genetischen Defekts, der die Sichelzellenanämie verursacht

Sichelzellpatienten wie Cassandra Trimnell und Evie James Junior und der UCSF-Arzt Mark Walters sprechen über die starken Schmerzen, die Menschen mit der Krankheit erfahren, und die potenziellen Vorteile einer CRISPR-Heilung.

Im Jahr 2014, zwei Jahre nach ihrer mit dem Nobelpreis ausgezeichneten Erfindung der CRISPR-Cas9-Genombearbeitung, hielt Jennifer Doudna die Technologie für ausgereift genug, um eine Heilung für eine verheerende Erbkrankheit, die Sichelzellenanämie, in Angriff zu nehmen, von der Millionen Menschen auf der ganzen Welt betroffen sind. die meisten von ihnen afrikanischer Abstammung. In den USA sind etwa 100.000 Schwarze von der Krankheit betroffen.

Unter Mobilisierung von Kollegen des damals neuen Innovative Genome Institute (IGI) – einer gemeinsamen Forschungskooperation zwischen der University of California, Berkeley und der UC San Francisco – versuchten sie, die einzelne Mutation zu reparieren, die dazu führt, dass sich rote Blutkörperchen verziehen und Arterien verstopfen, was zu qualvollen Schmerz und oft Tod. Die heute verfügbaren Behandlungen beinhalten in der Regel regelmäßige Transfusionen, obwohl Knochenmarktransplantationen diejenigen heilen können, die einen passenden Spender finden können.

Nach sechsjähriger Arbeit wurde diese experimentelle Behandlung nun von der US-amerikanischen Food and Drug Administration für klinische Studien zugelassen, wodurch erste Tests einer CRISPR-basierten Therapie am Menschen ermöglicht werden, um die für Sichel verantwortliche Mutation im Beta-Globin-Gen direkt zu korrigieren Zellkrankheit. Beta-Globin ist eines der Proteine ​​im Hämoglobinkomplex, das für den Transport von Sauerstoff durch den Körper verantwortlich ist.

Die Studien, die voraussichtlich vier Jahre dauern werden, werden von Ärzten des UCSF Benioff Children’s Hospital Oakland und des Broad Stem Cell Research Centers der UCLA geleitet, die diesen Sommer beginnen sollen, um sechs Erwachsene und drei Jugendliche mit schwerer Sichelzellanämie einzuschließen.

Das Labor für klinische Diagnostik des IGI, das unter der Leitung von Doudna errichtet wurde, um der Berkeley-Gemeinschaft kostenlose COVID-19-Tests zur Verfügung zu stellen, wird eine Schlüsselrolle bei der analytischen Unterstützung der Studie spielen, indem es Diagnostika entwickelt, um das Wohlbefinden der Patienten zu überwachen und die Effizienz der Behandlung.

"Wir sind motiviert, auf eine Heilung hinzuarbeiten, die für Patienten weltweit zugänglich und erschwinglich ist", sagte Doudna, Professor für Molekular- und Zellbiologie und Chemie an der UC Berkeley und Forscher am Howard Hughes Medical Institute. „Der Start dieser Studie ist ein wesentlicher erster Schritt auf diesem Weg.“

Dr. Mark Walters, Professor für Pädiatrie an der UCSF und Jordan Family Director des Blood and Mark Transplantation Program am UCSF Benioff Children’s Hospital Oakland, leitet die klinische Studie.
Bildnachweis: UCSF

In anderen Studien wurde CRISPR-Cas9 erfolgreich eingesetzt, um ein Gen auszuschalten, das das fötale Hämoglobin-Gen unterdrückt, das beim Menschen normalerweise ausgeschaltet ist. Diese Technik erweckt das fetale Gen wieder und hat bei mindestens drei Patienten die Symptome der Sichelzellenanämie gelindert.

Die neue Studie ist ein Gen-Knock-in: Die Forscher verwenden CRISPR-Cas9, um das defekte Beta-Globin-Gen durch eine reparierte Version zu ersetzen, mit dem Ziel, normale, erwachsene rote Blutkörperchen zu erzeugen und die Krankheit zu heilen.

„Diese Therapie hat das Potenzial, die Behandlung von Sichelzellanämie zu verändern, indem sie eine zugängliche, kurative Behandlung bietet, die sicherer ist als die derzeitige Therapie der Stammzelltransplantation von einem Knochenmarkspender“, sagte Dr. Mark Walters, Professor für Pädiatrie an der UCSF und Hauptprüfer der klinischen Studie und des Gen-Editing-Projekts. „Wenn dies bei jungen Patienten erfolgreich angewendet wird, hat es das Potenzial, irreversible Komplikationen der Krankheit zu verhindern.“

Patienten sind ihre eigenen Stammzellspender

Wie bei dem alternativen Ansatz, der das fetale Hämoglobin wiedererweckt, erfordert die Technik, dass einige der hämatopoetischen Stammzellen des Patienten – die Knochenmarkzellen, die alle roten Blutkörperchen des Körpers bilden – für die Gen-Editierung außerhalb des Körpers geerntet werden. Nachdem diese Zellen entfernt wurden, wird das verbleibende Knochenmark mit einer Chemotherapie zerstört, um Platz für das Wachstum der reparierten und reinfundierten Stammzellen zu schaffen.

Dr. Donald Kohn, angesehener Professor für Mikrobiologie, Immunologie und Molekulargenetik, Pädiatrie sowie molekulare und medizinische Pharmakologie an der David Geffen School of Medicine der UCLA und Mitglied des UCLA Broad Stem Cell Research Center, ist an verschiedenen Gentherapiestudien beteiligt für Krankheiten wie SCID und Sichelzellanämie.
Bildnachweis: UCLA

Walters, der auch Jordan Family Director des Blood and Marrow Transplantation Program am UCSF Benioff Children's Hospital Oakland ist, wird mit dem UCLA-Arzt-Wissenschaftler Dr. Donald Kohn zusammenarbeiten, der Gentherapien für verschiedene genetische Blutkrankheiten entwickelt hat, einschließlich einer Heilung für eine Form der schweren kombinierten Immunschwäche (SCID). Kohn leitet auch eine klinische Studie zu einer anderen Art der Gentherapie bei Sichelzellanämie, bei der ein neues Gen zu den Stammzellen von Patienten hinzugefügt wird, um die Sichelzellmutation zu überwinden.

„Gentherapie und Gen-Editierung ermöglichen es jedem Patienten, als eigener Stammzellspender zu dienen“, sagte Kohn, ein angesehener Professor für Mikrobiologie, Immunologie und Molekulargenetik, Pädiatrie sowie molekulare und medizinische Pharmakologie an der David Geffen School of Medicine an der UCLA und ein Mitglied des UCLA Broad Stem Cell Research Center. „Theoretisch sollten diese Ansätze viel sicherer sein als eine Transplantation von einer anderen Person und könnten allgemein verfügbar sein, da sie die Notwendigkeit beseitigen, die Nadel im Heuhaufen zu finden, die ein passender Stammzellspender ist.“

Kohn wird die Labor- und klinischen Studienaktivitäten an der UCLA leiten und die gesamte Herstellung des Arzneimittels namens CRISPR_SCD001 für die klinische Studie beaufsichtigen. Die präklinischen Arbeiten zur Entwicklung dieser Therapie wurden vom California Institute for Regenerative Medicine, der vom National Heart, Lung, and Blood Institute geleiteten Cure Sickle Cell Initiative und der Doris Duke Charitable Foundation finanziert.

Fyodor Urnov, IGI-Direktor für Technologie und Übersetzung und Professor für Molekular- und Zellbiologie an der UC Berkeley, wird die Bioinformatik- und Genomik-Aktivitäten für die Studie beaufsichtigen.

„Es ist bemerkenswert, dass diese neue Studie von einem Konsortium gemeinnütziger akademischer Einrichtungen stammt, die mit einer langfristigen Vision motiviert sind, die Krankheit mit einer erschwinglichen Lösung zu heilen, von der alle weltweit profitieren können, die sie brauchen“, sagte Urnov.

Fyodor Urnov, wissenschaftlicher Direktor für Technologie und Übersetzung am IGI, hat die Grundlagenforschung zu CRISPR-Therapien bei Sichelzellanämie geleitet.
Bildnachweis: Keegan Houser

Die Sichelzellenanämie wird durch eine einzige Veränderung des DNA-Codes des Beta-Globin-Gens verursacht. Die neue Studie verwendet die CRISPR-Cas9-Nuklease – ein vollständig zusammengesetztes Cas9-Protein und eine Leit-RNA-Sequenz, die auf die defekte Region des Beta-Globin-Gens abzielt, begleitet von einem kurzen DNA-Segment, das die richtige Sequenz kodiert –, um die Reparatur der Sichelmutation durch Substitution zu stimulieren das normale DNA-Segment für das abnormale. Bei diesem Ansatz werden die Blutstammzellen des Patienten zunächst mit elektrischen Impulsen behandelt, die Poren in ihren Membranen erzeugen. Diese Poren ermöglichen es der CRISPR-Cas9-Plattform, in die Stammzellen einzudringen und zu ihren Kernen zu reisen, um die Sichelzellenmutation zu korrigieren.

„Das Ziel dieser Form der Genom-Editing-Therapie ist es, die Mutation in genügend Stammzellen zu korrigieren, damit das resultierende Blut im Kreislauf die roten Blutkörperchen korrigiert hat“, sagte Walters. „Basierend auf unseren Erfahrungen mit Knochenmarktransplantationen sagen wir voraus, dass die Korrektur von 20 % der Gene ausreichen sollte, um die nativen Sichelzellen zu übertreffen und einen starken klinischen Nutzen zu haben.“

Das endgültige Herstellungsprotokoll verwendet eine virusfreie Methode zur Bearbeitung von Blutstammzellen und wurde in präklinischen Sicherheits-/Toxikologiestudien validiert, die nach Rücksprache mit der FDA durchgeführt wurden.

Zukünftige CRISPR-Therapien

Während UC-Ärzte die aktuelle CRISPR-Therapie in klinische Studien einführen, arbeiten IGI-Wissenschaftler daran, die Technik zu verbessern, damit die Korrektur der Sichelzellen-Mutation schließlich im Körper erfolgen kann, ohne Stammzellen zu entfernen oder das Knochenmark zu zerstören. Da das Knochenmark auch weiße Blutkörperchen produziert, die uns vor Krankheiten schützen, schwächt seine Zerstörung das Immunsystem und setzt Patienten einem erhöhten Infektions- oder sogar Krebsrisiko aus, bis sich die infundierten, korrigierten Stammzellen vermehren und wieder auffüllen können.

Die Sichelzellenanämie wird durch eine Mutation im Beta-Globin-Gen verursacht, die dazu führt, dass sich die roten Blutkörperchen in eine Sichelform (Vordergrund) verformen, verglichen mit der normalen kreisförmigen Form im Hintergrund. Die Sichelzellen verstopfen die Arterien, was zu starken Schmerzen und Organschäden führt.
Bildnachweis: Innovative Genomics Institute, UC Berkeley

„Derzeit führen wir eine Ex-vivo-Therapie durch, bei der Zellen aus dem Knochenmark entnommen werden, um die Mutation außerhalb des Körpers zu korrigieren“, sagte Ross Wilson, Direktor für therapeutische Verabreichung am IGI. „Aber während dieser Zeit – es könnte Monate dauern – füllt sich das Knochenmark wieder auf. Wenn es Zeit ist, die korrigierten Zellen zu infundieren, muss der Patient daher einer aggressiven Chemotherapie unterzogen werden, die das Knochenmark ausräumt und diesen korrigierten Zellen ermöglicht, ein Zuhause zu finden.“

Wilson ist optimistisch, dass er und die IGI-Wissenschaftler einen Weg finden können, die CRISPR-Therapie direkt an das Knochenmark im Körper zu senden, indem Antikörper verwendet werden, um das CRISPR-Enzym auf die richtigen Stammzellen zu richten. Andere Wissenschaftler, die manipulierte Viren oder Fetttröpfchen – Lipid-Nanopartikel – verwenden, um das CRISPR-Enzym in den Körper zu transportieren, sind bisher gescheitert.

„Das Molekül, das wir abzugeben versuchen, ist physikalisch kleiner – ein Achtel des Durchmessers der Nanopartikel, die andere Menschen versuchen, ins Knochenmark zu bringen – und dies könnte große Vorteile bringen“, sagte er. „Unser selbstabgebendes Enzym sollte in der Lage sein, das Knochenmark zu erreichen.“

Grafische Darstellung von CRISPR-Cas9, das die Mutation im Gen repariert, das die Sichelzellenanämie verursacht (in hellblau dargestellt).
Bildnachweis: UC Berkeley Bild mit freundlicher Genehmigung des Innovative Genomics Institute

Unabhängig von der erfolgreichen Strategie, sei es ex vivo oder in vivo, könnte die für Sichelzellanämie entwickelte CRISPR-Plattform die Gentherapie für andere Krankheiten verändern.

„Das ist die Vision von IGI: Erste Sichelzelle, aber unsere Bemühungen werden einen Welleneffekt haben, um Heilungen für Blutkrankheiten im Allgemeinen wie Beta-Thalassämie sowie Krankheiten des Immunsystems zu ermöglichen“, sagte er. „Die hämatopoetische Stammzelle ist die Saat für das gesamte Immunsystem, daher können theoretisch alle Blutkrankheiten durch eine solche Stammzelltherapie geheilt werden.“


Genom-Editierung B.C. (Vor CRISPR)

Genome Editing mit gentechnisch veränderten Nukleasen, ein leistungsstarkes Werkzeug zum Verständnis biologischer Funktionen und zum Aufdecken von Kausalitäten, wurde 1994–2010 in einer gemeinsamen Anstrengung von Wissenschaft und Industrie entwickelt. Die Verwendung von CRISPR/Cas9 ist die jüngste (2013–) und einfachste Implementierung der resultierenden Editing-Toolbox. Prinzipien und Methoden des Genome Editing aus der Zeit vor CRISPR bleiben relevant und weiterhin nützlich.

Am Anfang…

…war der Doppelstrangbruch (DSB). Induziert an einer bestimmten Position eines Säugetierchromosoms von Maria Jasin im Jahr 1994 (19 v. Chr. [vor CRISPR * ]), 1 es setzte eine Kette von Ereignissen in Gang, darunter wegweisende Studien von Dana Carroll (2000–2003 13–10 v. Chr.), 2–4 das brachte uns alle 2018 direkt zu genomeditierten Kartoffeln, 5 und Leute, 6 und eine Arche Noahs aus bearbeiteten Zellen und Organismen.

Als Ergebnis haben biomedizinische Wissenschaftler jetzt ein wirksames Mittel gegen ein ehemals lähmendes erkenntnistheoretisches Problem (Abbildung 1): In Ermangelung von Informationen füllt der menschliche Geist die Lücken mit Dingen aus es macht einfach aus. Genome Editing ist ein Werkzeug, um von diesen „einfach so Geschichten“ wegzukommen und näher an die biologische Realität zu kommen. Es ist auch das maßgebliche Instrument zur Bestimmung der Kausalität.

Die Toolbox des Editierens wurde zwischen 1994 und 2010 in einer gemeinsamen Anstrengung von Wissenschaft und Industrie entwickelt, wobei Meganukleasen als Proof-of-Concept verwendet wurden 7 und Zinkfingernukleasen (ZFNs) zum Editieren von nativen Loci. 8 In den Jahren 2010–2012 wurde die Toolbox schnell und en gros auf eine dritte Nukleaseklasse portiert – eine, die auf der TAL-Effektordomäne basiert. 9

In der Geschichte des industriellen Fortschritts gibt es mehrere Beispiele für einen „1 + 1 = 7“-Effekt aus der Konvergenz bisher unverbundener Anstrengungslinien. Aluminium, das 1825 entdeckt und 1886 in großem Maßstab gereinigt wurde, fand mit der Erfindung des Flugzeugs und dem Aufstieg der Luftfahrt in den 1910er Jahren seine weit verbreitete Verwendung. Die Corning Company entwickelte in den 1960er Jahren „Gorilla-Glas“ für die mögliche Verwendung in Auto- und Flugzeugwindschutzscheiben, das ein halbes Jahrhundert später als Oberfläche des iPhones allgegenwärtig wurde.

1987–1989 wurde an einem bestimmten Ort im Escherichia coliGenom – eine Anordnung, die heute als „clustered regular interspaced short palindromic repeat“ oder CRISPR bekannt ist. 10 ,11 Dies führte zu einem Vierteljahrhundert an Studien, die sich nicht auf Genom-Engineering, sondern auf bakterielle Immunität konzentrierten, die sich auf solche CRISPR-Loci konzentrierten. 12 ,13 Wie unten beschrieben, führte diese Arbeit schließlich im Jahr 2012 zu der Entdeckung, dass ein Schlüsselenzym eines spezifischen CRISPR-basierten Systems, Cas9, eine RNA-gesteuerte Endonuklease ist. 14 Diese Entdeckung fand aufgrund des jahrzehntelangen Präzedenzfalles der Genom-Editierung mit ZFNs und in jüngerer Zeit mit TAL-Effektornukleasen (TALENs) eine besondere Resonanz, die nichts mit der bakteriellen Immunität zu tun hatte. So schrieben Martin Jinek, Jennifer Doudna, Emmanuelle Charpentier und Kollegen 2012: „Zinkfinger-Nukleasen und Transkriptionsaktivator-ähnliche Effektor-Nukleasen haben als künstliche Enzyme, die zur Manipulation von Genomen entwickelt wurden, erhebliches Interesse geweckt. Wir schlagen eine alternative Methode vor, die auf RNA-programmiertem Cas9 basiert und ein erhebliches Potenzial für Gen-Targeting- und Genome-Editing-Anwendungen bieten könnte.“ 14 Kurze Zeit später, Gasiunas et al. schrieb: „Zusammengenommen ebnen diese Ergebnisse den Weg für die Entwicklung einzigartiger molekularer Werkzeuge für die RNA-gesteuerte DNA-Chirurgie.“ 15 Im Januar 2013 präsentierten Veröffentlichungen von vier Laboratorien – denen von George Church, Doudna, Jin-Soo Kim und Feng Zhang – Daten, die diesen Vorschlag in die Praxis umsetzen. 16–19

Die kurze Geschichte der CRISPR-Cas9-Geneditierung wurde bereits umfassend analysiert. Hier möchte ich die Erkenntnisse aus den etwa 18-jährigen Bemühungen zum Aufbau von Genome Editing diskutieren, die dem Zeitalter von CRISPR vorausgingen (Figur 2). Es konzentriert sich auf Prinzipien und Methoden, die für Genom-Editoren auch heute noch relevant und nützlich sind.


Abbildung. 2. Eine Zeitleiste mit bearbeiteten Zellen, Organismen, Bearbeitungsergebnissen und Nukleasen aus dem „B.C.“-Zeitalter. Die Organismen, von links nach rechts, sind: knospende Hefe und Mäuse (Gen-Targeting) Gewebekulturzellen Xenopus-Oozyten Drosophila melanogaster menschliche Gewebekulturzellen Zebrafisch Mais Ratte Maus Seidenspinner C. elegans, Xenopus tropicalis, Kaninchen, Schweinereis. 2–4,22–24,42,66–69,73,74,115–119 Dies ist eine repräsentative Liste, die darauf abzielt, die taxonomische Breite der Bearbeitung einer umfassenden Liste von Organismen zu zeigen, die in der Zeit vor B.C. Alter kann in Tabelle 2 von Ref. gefunden werden. 9. Artwork: (Tanya Sheremeta und Rae Senarighi Nukleasestrukturen mit freundlicher Genehmigung von J. Keith Joung.

Gentechnik vor der Bearbeitung: Von Mäusen und Hefe

Zwischen der Erfindung rekombinanter DNA 20 und DNA-Sequenzierung 21 in den 1970er Jahren und bis der Werkzeugkasten der Bearbeitung bis 2010 im Wesentlichen komplett war, 8 gezielte Gentechnik war die Domäne einiger ausgewählter Modellorganismen, deren Erforschung viel schneller vorankam als in anderen, genetisch widerspenstigen Systemen.

Gen-Targeting ist geboren. Die Labore von Gerry Fink und Ron Davis zeigten sich 22 ,23 dass ein Hefegen durch einen selektierbaren Marker ersetzt und somit ausgeknockt werden kann. Zum Beispiel transformierte das Davis-Labor Hefezellen mit einem Plasmid, in dem der Marker (URA3) wird flankiert von Homologiebereichen zum interessierenden Gen (HIS3). Die Selektion auf Marker-positive Zellen zeigt, dass URA3-positive Zellen tragen den Marker bei HIS3. Diese Methode wurde zu einer Hauptquelle der „großartigen Kraft der Hefegenetik“, und in den folgenden drei Jahrzehnten verwendet die Hefeforschungsgemeinschaft sie unter anderem, um eine Sammlung von null- und hypomorphen Allelen über das gesamte Hefegenom hinweg zu erstellen für reverse genetische Screens verwendet.

Gen-Targeting funktioniert in embryonalen Stammzellen (ES) der Maus. Inspiriert vom Vorbild der Hefe zeigte Mario Capecchi 24 dass ein Gen ausgewählt werden kann gegen in Maus-ES-Zellen (HPRT) kann ausgeschaltet werden, indem ein anderes Gen darauf ausgerichtet wird – ein Marker, der ausgewählt werden kann zum (neo r ). 1992 entdecken Michael Rudnicki und Rudolf Jaenisch, 25 im Zuge der Bemühungen, nicht selektierbare Gene auszuschalten, dass für ein effizientes Targeting lange Strecken isogener DNA benötigt werden. Viele elegante technische Verbesserungen werden von der Mausforschungsgemeinschaft erfunden, und wie bei Hefe wird das klassische Gen-Targeting (die Verwendung von Selektion, um ein Gen auf ein anderes zu übertragen) zur Grundlage für umfassende Sammlungen von Knockout-Maus-ES-Zellen und gentechnisch veränderten Mäusen auf raffinierte Weise. Die Verwendung von klassischem Gen-Targeting in anderen Umgebungen als Maus-ES-Zellen bleibt bis heute eine experimentelle Herausforderung (siehe unten).

Gen-Targeting kann in anderen Einstellungen als Maus-ES-Zellen funktionieren. John Sedivy verwendet unter anderem „Gen-Targeting-Vektoren“, um Gene, die mit der Zellzykluskontrolle in Verbindung stehen, in primären menschlichen Fibroblasten auszuschalten. 26 Die Ergebnisse regen zum Nachdenken an, was die technischen Herausforderungen im Zusammenhang mit dem Gen-Targeting zu einem bedauerlichen Merkmal des damaligen Stands des Feldes macht.

Das Gen-Targeting kann durch die Verwendung von Adeno-assoziierten Virus-(AAV)-Vektoren verbessert werden. David Russell macht die wichtige Entdeckung 27 dass sich seine Effizienz verbessert, wenn man AAV verwendet, um das „Gen-Targeting-Konstrukt“ bereitzustellen. Bert Vogelstein erweitert diese Beobachtung im Jahr 2004, um zu zeigen 28 dass in HCT116-Zellen die Verwendung von AAV-basiertem Gen-Targeting nach der Selektion 13 von 244 arzneimittelresistenten Klonen produziert, die ein Allel eines repräsentativen Gens aufweisen (CCR5) ausgeschlagen.

Gen-Targeting machte Hefe und Mäuse zu den dominanten genetischen Systemen, die zwischen 1980 und 2012 verwendet wurden. Bis 2005 hatten Genomingenieure jedoch nach elf Jahren Arbeit (siehe unten) nicht nur eine „bessere Mausefalle“ gefunden. Sie fanden a Katze: ein grundlegend neuer Weg zur Veränderung des Genoms, der weder Targeting-Vektoren noch Selektion erfordert, der jedes Allel in einem einzigen Schritt erzeugen kann und der sowohl in Organismen als auch in Zellen funktioniert. Diese „Katze“ ist natürlich Genome Editing. Wie unten zu sehen sein wird, leitet sich sein derzeitiger Nutzen und seine Allgegenwart aus einer durchdachten Zusammenarbeit mit Mutter Natur ab, insbesondere mit dem ebenso allgegenwärtigen Prozess der DSB-Reparatur.

Dauerhafte Lehren aus dem B.C. Alter

18 v. (1994): Ein DSB ist in Säugerzellen editogen

Dies war die erste wichtige Entdeckung des Zeitalters der Bearbeitung. Maria Jasin fand heraus, dass ein einzelnes DSB, das von einem Enzym an ein Säugetierchromosom in mitotisch teilenden Zellen abgegeben wird, entweder durch homologiegerichtete Reparatur (HDR) von einer vom Forscher bereitgestellten Matrize oder durch nichthomologe Endverbindung (NHEJ) effizient repariert wird. 1

Um diesen Befund zu würdigen, etwas Kontext. 1982, Jeffrey Strathern et al. entdeckten, dass ein DSB den Transfer genetischer Informationen während des Wechsels des Paarungstyps in knospenden Hefen initiiert, 29 und in den folgenden Jahrzehnten wurde eine Fülle von Erkenntnissen über die Rolle von DSBs beim genetischen Austausch gewonnen, insbesondere von Jim Haber, 30, der dieses System untersuchte . 31 1983 schlugen Jack Szostak, Terry Orr-Weaver, Rodney Rothstein und Franklin Stahl vor, dass ein DSB das initiierende Ereignis der meiotischen Rekombination ist. 32 In den späten 1980er Jahren hielt das Dogma auf dem Gebiet der DNA-Reparatur, dass End-Joining und nicht HDR der dominante DSB-Weg in mitotisch teilenden Säugerzellen in Kultur ist (dies beruhte teilweise auf der geringen Effizienz des klassischen Gen-Targeting).

Jasins Interesse an diesem Problem begann, als sie Ende der 1980er Jahre Postdoktorandin bei Paul Berg war. Sie begann ihr Labor 1990 am Memorial Sloan Kettering, wo sie argumentierte (siehe Ergänzende Datenbox 1 „Das Buch von Jasin“, Ergänzende Daten sind online unter www.liebertpub.com/crispr verfügbar), dass dieses Problem mit einer Nuklease gelöst werden könnte, die (1) würde ein einzelnes DSB im Chromosom einer Säugerzelle induzieren und (2) würde von dieser Zelle toleriert. Im ersten von mehreren bemerkenswerten „Sprung über Arten“, von denen das Gebiet der Genom-Editierung profitiert hat, hat sie ein 1985 von Bernard Dujon entdecktes Enzym umfunktioniert: eine Nuklease, I-SceI, die sich entwickelt hat, um in Hefe-Mitochondrien zu funktionieren, um ein 18 Basenpaare (bp) Zielstelle und breitet dadurch seinen eigenen offenen Leserahmen aus. 33 Das Experiment nutzte ein chromosomales Reportergen, bei dem ein selektierbarer Marker durch die Erkennungsstelle von I-SceI unterbrochen war, und so konnte die Selektion verwendet werden, um seltene interessierende Zellen aufzuspüren. Zellen, die mit einem 700 bp-Fragment transfiziert waren, das die Wildtyp-Markersequenz trägt, produzierten keine Wildtyp-Nachkommenschaft. Die gemeinsame Abgabe der DSB-induzierenden Nuklease produzierte jedoch eine Fülle davon, und eine Analyse ihrer DNA-Sequenzen zeigte, dass sie aus dem HDR-basierten Ersatz der Nuklease-Zielstelle durch Wildtyp-DNA resultierten. Die alleinige Abgabe der Nuklease erzeugte auch Wildtypzellen, wobei die Sequenzanalyse zeigte, dass sie aus einer mikrohomologiegesteuerten, endverknüpfenden Eliminierung der Nukleasestelle aus dem Reportergen resultierten. Aus einem Experiment mit einem Reporterkonstrukt kamen somit drei Schlussfolgerungen, die bis heute Nachhall finden: (1) In mitotisch teilenden Säugerzellen in Kultur verstärkt ein Nuklease-induziertes DSB den HDR-basierten Transfer genetischer Information in das Chromosom von einem ektopen Fragment (2) NHEJ ist ein konkurrierender Weg zur Reparatur dieses DSB, der kleine Insertionen und Deletionen (Indels) am Nuklease-Target erzeugt und (3) die Expression einer solchen Nuklease wird von Säugerzellen toleriert.

Horace Judsons unvergleichliche Geschichte der Molekularbiologie, Der achte Tag der Schöpfung, erzählt von dem Moment, als Francis Crick ins Labor kam, in dem Leslie Barnett gerade die Ergebnisse des legendären „Onkels und Tanten“-Experiments erhalten hatte, bei dem gefragt wurde, wie viele Basenpaare jeder „Buchstabe“ des genetischen Codes bilden. 34 Crick betrachtete die Platten mit den Phagenplaketten, dann sah er Barnett an und sagte: „Du und ich sind die einzigen beiden Menschen auf der Erde, die wissen, dass der genetische Code ein Triplett ist.“ Philippe Rouet, Fatima Smih und Jasin gehörten bei der Untersuchung der durch I-SceI induzierten Indels und präzise reparierten Chromosomen zu diesem Zeitpunkt 1993 oder Anfang 1994 zu dieser seltenen Kategorie von Wissenschaftlern: einzigartig in ihrem Wissen über eine grundlegend wichtige Wahrheit.

13–10 v. Chr. (2000–2003): Ein Enzym kann so konstruiert werden, dass es ein DSB induziert und die Bearbeitung an einem interessierenden Ort in eukaryotischen Zellen vorantreibt

Dies war die zweite wichtige Entdeckung des Zeitalters der Bearbeitung. Im Bewusstsein der Implikationen der Jasin-Ergebnisse (targeted DSB = Editing!) und der Herausforderungen beim Reengineering von Meganukleasen für interessierende Gene hat Dana Carroll sein Augenmerk auf ein kürzlich erfundenes Engineering-Restriktionsenzym gerichtet: das ZFN (eine Fusion zwischen einem Zinkfinger- basierte DNA-Bindungsdomäne und die Spaltungsdomäne von einem Restriktionsenzym, FokICH). ZFNs wurden ursprünglich auf Anregung von Hamilton Smith vom Chandrasegaran-Labor zur Verwendung als neuartige Restriktionsenzyme gebaut. 35 In einem anschaulichen Beispiel dafür, wie schwierig es ist, den Weg der technologischen Entwicklung vorherzusagen, fanden diese manipulierten Enzyme ihre wahre Berufung in einer Umgebung, die völlig unabhängig von ihrer Erfindung war.

Dana Carroll wurde bei Don Brown ausgebildet und war sich bei der Gründung seines eigenen Forschungslabors an der University of Utah der einzigartigen Kraft der Xenopus Eizelle als Modellsystem: Es ermöglicht die schnelle Bewertung der Wirkung einer Vielzahl von DNA-bindenden Proteinen auf eine beliebige Anzahl von konstruierten Templates in der Zelle. 36 Außerdem wurden Zinkfinger von Aaron Klug in . entdeckt Xenopus, 37 und obwohl sie die dominierende Klasse von DNA-bindenden Domänen über alle Metazoen hinweg darstellen, 38 wenn es eine Spezies gäbe, bei der ein neues Enzym auf Zinkfingerbasis eine Chance hatte, dann war es Xenopus. Carroll nutzte dieses System mit aller Kraft, um die biochemischen Parameter zu identifizieren, die die effiziente Zielerkennung, das Schneiden und die Rekombination auf einem Plasmid-Templat durch ZFNs in der Eizelle steuern. 2 Die Voraussetzungen für die Bearbeitung eines Gens waren nun geschaffen (siehe Ergänzende Datenbox 1: „The Book of Carroll“).


Materialen und Methoden

Plasmidkonstruktion

pEntry-sgRNA wurde von Mutagenex (530 Highland Station Dr., Suwanee, GA) wie folgt erzeugt. Das U6-sgRNA-Fragment aus dem pU6-(BbsI)_Cbh-Cas9-T2A-mCherry-Plasmid (Addgene #6432446) wurde mit Primern mit attL1- und attL2-Sequenzen PCR-amplifiziert und in pEAR A1A subkloniert (Ergänzende Fig. 9).

Das pShuttle-Cas9-DEST-Plasmid wurde durch zwei Subklonierungsschritte konstruiert. Zuerst wurde das Cbh-Cas9-T2A-mCherry-polyA-Fragment aus dem pU6-(BbsI)_Cbh-Cas9-T2A-mCherry-Plasmid (Addgene #64324) in die XbaI- und NotI-Stellen von pShuttle (Addgene #1640221) subkloniert. Dann wurde das R1-CmR-ccdB-R2-Fragment aus dem Gateway-pDEST (ThermoFisher Scientific, Hampton, NH) in den Zwischenvektor subkloniert (ergänzende Fig. 10).

pAdTrack-Cas9-Dest wurde durch Subklonieren von Cbh-Cas9- und polyA-Fragmenten aus dem pU6-(BbsI)_Cbh-Cas9-T2A-mCherry-Plasmid (Addgene #64324) und dem R1-CmR-ccdB-R2-Fragment aus dem Gateway pDEST . konstruiert in KpnI/HidIII-, HindIII- bzw. KpnI-Stellen von pAdTrack (Addgene #16404 21 ) (ergänzende Fig. 11).

Erzeugung von pEntry-sgRNA-Amplikons durch zweistufige PCR und LR-Klonierung

Die erste PCR-Runde wurde unter Verwendung von zwei Primersätzen durchgeführt, wie in Tabelle 1 beschrieben. Die zweite PCR-Runde wurde unter Verwendung einer Mischung von zwei PCR-Produkten (jeweils 1 ul 100-fach verdünntes PCR-Produkt) als Matrizen und L1 + L2 . durchgeführt Primer (Tabelle 1). Es wurden die gleichen Temperaturwechselbedingungen verwendet. Beachten Sie, dass zusätzliche c und g (Kleinbuchstaben) an U6-Rev- und Scaff-fwd-Primer angehängt wurden, damit die sgRNA mit „G“ beginnen kann, wenn die Zielsequenz nicht mit „G“ beginnt, wie von Ran . empfohlen et al. 4 Die endgültigen PCR-Produkte wurden gereinigt und entweder mit pShuttle-Cas9-DEST oder pAdTrack-Cas9-DEST zusammen mit LR-Klonase (Thermo Fisher Scientific #11791020) gemischt, um endgültige All-in-One-Vektoren zu erzeugen. Bacterial colonies transformed with the reaction mixture were screened by colony PCR that amplifies DNA region flanked by R1 and R2 (negative clones), or B1 and B2 (positive recombinants). Two different sets of primers were used for pShuttle and pAdTrack as follows.

attR1 Up Fwd: 5′-GAGCCCACTGCTTACTGGCTTATC-3′

Cbh Rev: 5′-CGTACTTGGCATATGATACACTTGA-3′

Size of PCR amplicons: 1,966 bp negative clone and 691 bp for positive recombinant.

Size of PCR amplicons: 1820 bp for negative clone and 545 bp for positive recombinant.

Transfection and T7E1 assay

A U2OS cell line expressing luciferase under a Bmal1 promoter was described previously. For transfection with the all-in-one plasmids, cells were plated into 6 cm dishes to be approximately 60% confluent on the day of transfection. Cells were transfected with Polyfect (Qiagen, Hilden, Germany) according to the manufacturer’s protocol and incubated for 2 days before they were subjected to trypsinization and FACS sorting using BD FACSAria SORP equipped with an Automated Cell Deposition Unit (ACDU) for sorting into 96 well plates. Cells were trypsinized with Trypsin (0.25%)-EDTA (2.21 mM) for 3 min and were filtered through mesh with 50um pores. FACS-sorted cells were collected into three groups: negative, intermediate and bright mCherry, and plated into 35 mm dishes and grown for 2 days before harvest and genomic DNA extraction. Before the cells were harvested, they were inspected for mCherry expression. Even the bright mCherry group included 10–30% of non-mCherry cells. Harvested cell pellets were homogenized in 250 ul solution A containing 0.1 M Tris-HCl pH = 9.0, 0.1 M EDTA, and 1% SDS, and incubated at 70 °C for 30 minutes. 35 ul 8 M potassium acetate was added and incubated at room temperature for 5 minutes. The samples were centrifuged at 13,000 rpm for 15 minutes and genomic DNA was purified by subjecting the supernatant to phenol-chloroform extraction and ethanol precipitation. The extracted genomic DNA pellet was dissolved in 100 ul water and used as a template to PCR amplify the target genomic locus with a set of primers (Table 2) flanking the target region. Amplicons were confirmed by agarose electrophoresis, and purified with PCR purification kit (QIAGEN Cat.28104). 200 ng DNA samples were denatured and annealed according to the protocol in Ran et al. and subjected to T7E1 digestion in a 20 ul reaction according to the manufacturer’s protocol (NEB cat.M0302). Digestion products were resolved on 8% acrylamide/bis TBE gel and visualized with EtBr.

TOPO-PCR cloning and sequencing

PCR amplicons obtained above were cloned into plasmids using the TOPO-PCR cloning kit (Invitrogen #K2800), and inserts were sequenced from 20 colonies each for Bmal1 exon 7 and Pro2 exon 15. Wt contamination was confirmed: 4 out of 16 were wt for Bmal1 exon 6 and 2 out of 15 were wt for Pro2.

Single cell isolation and expansion, bioluminescence monitoring and immunoblotting

mCherry-expressing cells were singly sorted into 96 well plates by FACS and expanded serially into 24 well plates, 6 well plates, and then 10 cm dishes. A few dozen clones for each of Bmal1 exon 6, 8 and 9, and Pro2 exon 5 were set up for bioluminescence monitoring as described previously 19 . For immunoblotting for BMAL1, a previously described anti-BMAL1 antibody (GP3) was used 47 . For human PER2, novel polyclonal anti human PER2 antibodies were generated in guinea pigs using aa 1–200 peptide by Cocalico Biologicals, Inc (449 Stevens Rd, Reamstown, PA). hP2-GP49 was used in the current study. The antibody was validated by oscillations of human PER2 in U2OS cells and a novel monoclonal antibody against human PER2 (hP2-C6A3). The monoclonal antibody was selected from clones of antibodies raised against aa 1–200 of human PER2 by Boreda Biotech (Seongnam, Gyeonggi-Do, Korea). The monoclonal antibody was also able to detect oscillations of PERs in U2OS cells similarly (Supplementary Fig. 7). Uncropped immunoblot images are shown in Supplementary Fig. 12.

Generation of adenovirus

Adenoviruses expressing mutant BMAL1 lacking the DNA-binding domain or wt BMAL1 were described previously 19,38 . To generate adenovirus expressing Cas9 and sgRNA targeting Bmal1 exon 6, pAdTrack-Cas9-U6-Bmal1E6 sgRNA plasmid was used to transform electrocompetent BJ5183 cells harboring pAdEasy1 by electroporation. Positive recombinants were selected by PacI digestion and transfected into the packaging cell line 293A in a T25 flask. Cells were harvested along with the medium 10–12 days later. Adenovirus was released from the cells by freezing and thawing cells + medium three times and harvested by centrifugation. The supernatant was used to infect confluent 293 cells in two T75 flasks. Final adenoviral prep was obtained by 3 cycles of freezing-thawing cell + medium from two T75 flasks and centrifugation. The final lysate contains

3 × 10 7 transducing units (TU). When compared with 293 cells, expression forming units (efu) of the adenovirus was 5–10 fold lower for U2OS cells. However, U2OS cells could be infected with

100% efficiency without further purification, unlike infection for MEFs 19 . To ensure 100% infection in U2OS cells with the all-in-one adenovirus, the cells were infected at MOI of 50 twice, two days apart.


Biological Intervention of CRISPR/Cas9 in Clinical Trials

Cancer Immunotherapy

The first CRISPR Phase 1 clinical trial in the US opened in 2018 with the intent to use CRISPR/Cas9 to edit autologous T cells for cancer immunotherapy against several cancers with relapsed tumors and no further curative treatment options. These include multiple myeloma, melanoma, synovial sarcoma and myxoid/round cell liposarcoma. This trial was approved by the United States Food and Drug Administration (FDA) after careful consideration of the risk to benefit ratios of this first application of CRISPR gene therapy into the clinic. During this trial, T lymphocytes were collected from the patients' blood and Ex-vivo engineered with CRISPR/Cas9 to knockout the α and β chains of the endogenous T cell receptor (TCR), which recognizes a specific antigen to mediate an immune response, and the programmed cell death-1 (PD-1) protein, which attenuates immune response. The cells were then transduced with lentivirus to deliver a gene encoding a TCR specific for a NY-ESO-1 antigen, which has been shown to be highly upregulated in the relapsed tumors and thus can serve as a therapeutic target. Since then, many trials have opened for CRISPR-mediated cancer immunotherapy and is currently the most employed strategy for CRISPR gene therapy ( Table 2 ). A trial implementing this strategy using other tools had already been conducted in both pre-clinical and clinical settings, but this was the first time CRISPR/Cas9 was used to generate the genetically modified T cells (97). The moderate transition of switching only the tool used for an already approved therapeutic strategy may have been key to paving the road for using CRISPR's novel abilities for gene manipulation, such as targeted gene disruption.

Tabelle 2

Biological intervention of CRISPR gene therapy in clinical trials.

Sponsor/affiliationKrankheitGene targetClinial Trial IDCRISPR-Cas9 mediated intervention
University of Pennsylvania/Parker Institute for Cancer Immunotherapy/TmunityMultiple Myeloma, Melanoma, Synovial Sarcoma, Myxoid/Round Cell LiposarcomaTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03399448","term_id":"NCT03399448">> NCT03399448NY-ESO-1 redirected autologous T cells with CRISPR edited endogenous TCR and PD-1
Affiliated Hospital to Academy of Military Medical Sciences/Peking University/Capital Medical UniversityHIV-1CCR5 <"type":"clinical-trial","attrs":<"text":"NCT03164135","term_id":"NCT03164135">> NCT03164135CD34+ hematopoietic stem/progenitor cells from donor are treated with CRISPR/Cas9 targeting CCR5 gene
CRISPR Therapeutics AGMultiple MyelomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT04244656","term_id":"NCT04244656">> NCT04244656CTX120 B-cell maturation antigen (BCMA)-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified Ex-vivo using CRISPR-Cas9 gene editing components
Crispr Therapeutics/VertexBeta-Thalassemia, Thalassemia, Genetic Diseases Inborn, Hematologic Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03655678","term_id":"NCT03655678">> NCT03655678CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Crispr TherapeuticsB-cell MalignancyNon-Hodgkin LymphomaB-cell LymphomaTCRα, TCRβ <"type":"clinical-trial","attrs":<"text":"NCT04035434","term_id":"NCT04035434">> NCT04035434CTX110 (CD19-directed T-cell immunotherapy comprised of allogeneic T cells genetically modified Ex-vivo using CRISPR-Cas9 gene editing components)
Editas Medicine, Inc./AllerganLeber Congenital Amaurosis 10CEP290 <"type":"clinical-trial","attrs":<"text":"NCT03872479","term_id":"NCT03872479">> NCT03872479Single escalating doses of AGN-151587 (EDIT-101) administered via subretinal injection
Vertex Pharmaceuticals Incorporated/CRISPR TherapeuticsSickle Cell Disease, Hematological Diseases, HemoglobinopathiesBCL11A <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287CTX001 (autologous CD34+ hHSPCs modified with CRISPR-Cas9 at the erythroid lineage-specific enhancer of the BCL11A gene)
Allife Medical Science and Technology Co., Ltd.ThalassämieHBB <"type":"clinical-trial","attrs":<"text":"NCT03728322","term_id":"NCT03728322">> NCT03728322Investigate the safety and efficacy of the gene correction of HBB in patient-specific iHSCs using CRISPR/Cas9
Yang Yang, The Affiliated Nanjing Drum Tower Hospital of Nanjing University Medical SchoolStage IV Gastric Carcinoma, Stage IV Nasopharyngeal Carcinoma, T-Cell Lymphoma Stage IV, Stage IV Adult Hodgkin Lymphoma, Stage IV Diffuse Large B-Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03044743","term_id":"NCT03044743">> NCT03044743CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
First Affiliated Hospital, Sun Yat-Sen University/Jingchu University of TechnologyHuman Papillomavirus-Related Malignant NeoplasmHPV16 and HPV18 E6/E7 DNA <"type":"clinical-trial","attrs":<"text":"NCT03057912","term_id":"NCT03057912">> NCT03057912Evaluate the safety and efficacy of TALEN-HPV E6/E7 and CRISPR/Cas9-HPV E6/E7 in treating HPV Persistency and HPV-related Cervical Intraepithelial NeoplasiaI
Sichuan University/Chengdu MedGenCell, Co., Ltd.Metastatic Non-small Cell Lung CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02793856","term_id":"NCT02793856">> NCT02793856CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityMetastatic Renal Cell CarcinomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867332","term_id":"NCT02867332">> NCT02867332CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityHormone Refractory Prostate CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02867345","term_id":"NCT02867345">> NCT02867345CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Peking UniversityInvasive Bladder Cancer Stage IVPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT02863913","term_id":"NCT02863913">> NCT02863913CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Hangzhou Cancer Hospital/Anhui Kedgene Biotechnology Co., LtdEsophageal CancerPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03081715","term_id":"NCT03081715">> NCT03081715CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Chinese PLA General HospitalSolid Tumor, AdultTCRα, TCRβ, PDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03545815","term_id":"NCT03545815">> NCT03545815Evaluate the feasibility and safety of CRISPR-Cas9 mediated PD-1 and TCR gene-knocked out chimeric antigen receptor (CAR) T cells in patients with mesothelin positive multiple solid tumors
Baylor College of Medicine/The Methodist Hospital SystemT-cell Acute Lymphoblastic Leukemia, T-cell Acute Lymphoblastic Lymphoma, T-non-Hodgkin LymphomaCD7 <"type":"clinical-trial","attrs":<"text":"NCT03690011","term_id":"NCT03690011">> NCT03690011CRISPR-Cas9 mediated CD7 knockout-T cells from autologous origin
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03398967","term_id":"NCT03398967">> NCT03398967Determine the safety of the allogenic CRISPR-Cas9 gene-edited dual specificity CD19 and CD20 or CD22 CAR-T cells
Chinese PLA General HospitalB Cell Leukemia, B Cell LymphomaTCRα, TCRβ, B2M <"type":"clinical-trial","attrs":<"text":"NCT03166878","term_id":"NCT03166878">> NCT03166878CRISPR-Cas9 mediated TCR and B2M knockout-T cells from allogenic origin for CD19 CAR-T
Chinese PLA General HospitalSolid Tumor, AdultPDCD1 <"type":"clinical-trial","attrs":<"text":"NCT03747965","term_id":"NCT03747965">> NCT03747965CRISPR-Cas9 mediated PD-1 knockout-T cells from autologous origin
Xijing Hospital/Xi'An Yufan Biotechnology Co., LtdLeukemia, LymphomaHPK1 <"type":"clinical-trial","attrs":<"text":"NCT04037566","term_id":"NCT04037566">> NCT04037566CRISPR Gene Edited to Eliminate Endogenous HPK1 (XYF19 CAR-T Cells)

Gene Disruption

The first clinical trial in the US using CRISPR to catalyze gene disruption for therapeutic benefit were for patients with sickle-cell anemia (SCD) and later β-thalassemia, by Vertex Pharmaceuticals and CRISPR Therapeutics. This therapy, named CTX001, increases fetal hemoglobin (HbF) levels, which can occupy one or two of four hemoglobin binding pockets on erythrocytes and thereby provides clinical benefit for major β-hemoglobin diseases such as SCD and β-thalassemia (103). The trial involved collecting autologous hematopoietic stem and progenitor cells from peripheral blood and using CRISPR/Cas9 to disrupt the intronic erythroid-specific enhancer for the BCL11A gene ( <"type":"clinical-trial","attrs":<"text":"NCT03745287","term_id":"NCT03745287">> NCT03745287) as disruption of this gene increases HbF expression (104�). Genetically modified hematopoietic stem cells with BCL11A disruption are delivered by IV infusion after myeloablative conditioning with busulfan to destroy unedited hematopoietic stem cells in the bone marrow. Preliminary findings from two patients receiving this treatment seem promising. One SCD patient was reported to have 46.6% HbF and 94.7% erythrocytes expressing HbF after 4 months of CTX001 transfusions and one β-thalassemia patient is expressing 10.1 g/dL HbF out of 11.9 g/dL total hemoglobin, and 99.8% erythrocytes expressing HbF after 9 months of the therapy. Results from the clinical trial that has opened for this therapy ( <"type":"clinical-trial","attrs":<"text":"NCT04208529","term_id":"NCT04208529">> NCT04208529) to assess the long-term risks and benefits of CTX001 will dictate whether this approach can provide a novel therapeutic opportunity for a disease that otherwise has limited treatment options.

In vivo CRISPR Gene Therapy

While the aforementioned trials rely on Ex-vivo editing and subsequent therapy with modified cells, in vivo approaches have been less extensively employed. An exciting step forward with CRISPR gene therapy has been recently launched with a clinical trial using in vivo delivery of CRISPR/Cas9 for the first time in patients. Während in vivo editing has been largely limited by inadequate accessibility to the target tissue, a few organs, such as the eye, are accessible. Leber congenital amaurosis (LCA) is a debilitating monogenic disease that results in childhood blindness caused by a bi-allelic loss-of-function mutation in the CEP290 gene, with no treatment options. This therapy, named EDIT-101, delivers CRISPR/Cas9 directly into the retina of LCA patients specifically with the intronic IVS26 mutation, which drives aberrant splicing resulting in a non-functional protein. The therapy uses an AAV5 vector to deliver nucleic acid instructions for Staphylococcus aureus Cas9 and two guides targeting the ends of the CEP290 locus containing the IVS26 mutation. The DSB induced by Cas9 and both guides result in either a deletion or inversion of the IVS26 intronic region, thus preventing the aberrant splicing caused by the genetic mutation and enabling subsequent translation of the functional protein (107). Potential immunotoxicity or OTEs arising from nucleic acid viral delivery will have to be closely monitored. Nonetheless, a possibly curative medicine for genetic blindness using an in vivo approach marks an important advancement for CRISPR gene therapy.

CRISPR Editing in Human Embryos and Ethical Considerations

While somatic editing for CRISPR therapy has been permitted after careful consideration, human germline editing for therapeutic intent remains highly controversial. With somatic edition, any potential risk would be contained within the individual after informed consent to partake in the therapy. Embryonic editing not only removes autonomy in the decision-making process of the later born individuals, but also allows unforeseen and permanent side effects to pass down through generations. This very power warrants proceeding with caution to prevent major setbacks as witnessed by traditional gene therapy. However, a controversial CRISPR trial in human embryos led by Jiankui He may have already breached the ethical standards set in place for such trials. This pilot study involved genetic engineering of the C-C chemokine receptor type 5 (CCR5) gene in human embryos, with the intention of conferring HIV-resistance, as seen by a naturally occurring CCR5Δ32 mutation in a few individuals (108). However, based on the limited evidence, CRISPR/Cas9 was likely used to target this gene, but rather than replicate the naturally observed and beneficial 32-base deletion, the edits merely induced DSBs at one end of the deletion, allowing NHEJ to repair the damaged DNA while introducing random, uncharacterized mutations. Thus, it is unknown whether the resultant protein will function similarly to the naturally occurring CCR5Δ32 protein and confer HIV resistance. In addition, only one of the two embryos, termed with the pseudonym Nana, had successful edits in both copies of the CCR5 gene, whereas the other embryo, with pseudonym Lulu, had successful editing in only one copy. Despite these findings, both embryos were implanted back into their mother, knowing that the HIV-resistance will be questionable in Nana and non-existent in Lulu (109, 110).

Furthermore, recent studies have shown that the mechanism for infection of some variants of the highly mutable HIV virus may heavily rely on the C-X-C chemokine receptor type 4 (CXCR4) co-receptor (108, 111). With no attempts at editing CXCR4, this adds yet another layer of skepticism toward achieving HIV resistance by this strategy. In addition, OTEs, particularly over the lifetime of an individual, remain a major concern for applying this technology in humans. The recent advances in the editing tool to limit OTEs, such as using high fidelity Cas9 variants, has not been exploited. Furthermore, the rationale for selecting HIV prevention for the first use of CRISPR in implanted human embryos contributes to the poor risk to benefit ratio of this study, considering HIV patients can live long, healthy lives on a drug regimen. A more appropriate first attempt would have been to employ this technology for a more severe disease. For example, correction of the MYBPC3 gene is arguably a better target for embryonic gene editing, as mutations in MYBPC3 can cause hypertrophic cardiomyopathy (HCM), a heart condition responsible for most sudden cardiac deaths in people under the age of 30. Gene correction for this pathological mutation was achieved recently for the first time in the US in viable human embryos using the HDR-mediated CRISPR/Cas9 system. However, these embryos were edited for basic research purposes and not intended for implantation. In this study, sperm carrying the pathogenic MYBPC3 mutation and the CRISPR/Cas9 machinery as an RNP complex were microinjected into healthy donor oocytes arrested at MII, achieving 72.4% homozygous wildtype embryos as opposed to 47.4% in untreated embryos. The HDR-mediated gene correction was observed at considerably high frequencies with no detectable OTEs in selected blastomeres, likely owing to the direct microinjection delivery of the RNP complex in the early zygote. Interestingly, the maternal wildtype DNA was used preferentially for templated repair over the provided exogenous ssODN template (112). While evidence for gene correction was promising, NHEJ mediated DNA repair was still observed in many embryos, highlighting the need to improve HDR efficiency before clinical application can be considered. Although strategies have been developed to improve HDR, such as chemical inhibitors of NHEJ (77�), such techniques may have varying outcomes in embryonic cells and side effects that may arise from treatment needs to be investigated. Germline gene editing will remain to be ethically unfavorable at its current state and its discussions may not be considered until sufficient long-term studies of the ongoing somatic CRISPR therapy clinical trials are evaluated.


Gene Drives

Yet another fascinating application of CRISPR is a tool called a gene drive. Originally conceived by Harvard biologist Kevin Esvelt, a gene drive is a synthetic segment of DNA that includes the Cas9 gene and a guideRNA gene, along with a particular gene of interest (also called payload DNA), all in one self-functioning unit (Esvelt et al., 2014). The payload DNA can be a new gene or a modified version of an existing gene.

Once a gene drive is introduced into the chromosome of a diploid organism, the drive will generate a Cas9/guideRNA complex that will cut the homologous chromosome and then copy the gene drive into the break via HDR. With the gene drive now present in both chromosomes, the organism is homozygous for the drive, including the payload DNA (Figure 8).

Structure of a CRISPR gene drive. (EIN) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (B) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (C) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Structure of a CRISPR gene drive. (EIN) The drive is initially present in one of the homologous chromosomes. The drive expresses the Cas9 enzyme and guideRNA, which form a CRISPR-Cas9 complex. (B) The enzyme complex cuts the other homologous chromosome at the designated target sequence. The chromosome containing the gene drive can then serve as a template for homology-directed repair. (C) As such, the gene drive is copied into the cut chromosome at the site of repair, ensuring that both chromosomes have a copy of the drive.

Gene drives are capable of knocking-in or knocking-out genes in an organism. More importantly, gene drives can be propagated into an entire population of organisms via sexual reproduction, thus allowing for genetic modification at the population level.

Consider Figure 9A, which shows how a gene is propagated in a population via normal inheritance – that is, with no gene drives involved. If one of the original parents is heterozygous for a gene of interest, then the gene should statistically be transmitted to half of the offspring. This pattern of inheritance would continue in subsequent generations with the gene never accumulating to an appreciable level within the population.

WTvhUkCteg0tUw9cs3JGHWqWdw9F8zV-qwoTKX5WVSQAzgISOD6ZhB-t1DdB9QS0rryNrBEw0yZIVVaaQ0mMj9o0RIOdStWb1hQ__&Key-Pair-Id=APKAIE5G5CRDK6RD3PGA" alt="Normal vs. gene-drive-based inheritance. (A) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

Normal vs. gene-drive-based inheritance. (EIN) One of the original parents is heterozygous for a gene of interest. With normal processes of sexual inheritance this gene will be continually passed to

50% of the offspring but will never accumulate in the population at large. (B) One of the original parents is heterozygous for the gene of interest, which is located within a gene drive. The gene drive copies the drive and gene of interest into the other homologous chromosome, thus making the parent homozygous. As such, the gene drive is passed to 100% of the offspring. The offspring are initially heterozygous for the gene and drive but, like the parent, become homozygous. Thus, the gene of interest is rapidly propagated into the population.

Now look at how the gene could be propagated using a gene drive (Figure 9B). The original parent would initially be heterozygous for the gene drive (including the gene of interest), but the drive itself would ensure that it is copied into the homologous chromosome, thus making the parent homozygous for the drive and payload gene. Zygotes in the first generation of offspring would initially be heterozygous for the gene drive, but once again, the drive would copy itself into the homologous chromosome, ensuring that the offspring become homozygous. This pattern of inheritance would continue in subsequent generations with the drive and gene of interest becoming increasingly present within the population. So, how might this technology be used?

In one interesting application, scientists are hoping to use gene drives to eliminate malaria, a disease that continues to kill over a million people every year. The malarial parasite is transmitted by the Anopholes Moskito. Researchers created a gene drive that makes females of the species reproductively sterile (Hammond et al., 2015). Introducing the gene drive into the environment could conceivably drive the mosquito species to extinction and help eradicate the disease. In February 2019, researchers in Italy began a large-scale release of the CRISPR-edited mosquitos into a controlled high-security environment. If the technology works, gene drives could be used to address other insect-borne diseases, such as Zika virus. Moreover, gene drives could help eradicate invasive pests and create more efficient crops.

Gene drives represent an extremely powerful technology with the potential to alter entire populations of organisms. Indeed, the enormous power of gene drives has not gone unnoticed by the U.S. government. In 2016, the director of national intelligence added gene editing to a list of threats posed by “Weapons of Mass Destruction and Proliferation.” Ironically, Esvelt's lab is already working on an antidote to gene drives: a gene drive programmed to remove another gene drive.


HnRNP A2B1 (HNRNPA2B1) Human Gene Knockout Kit (CRISPR)

HNRNPA2B1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

Product images

Spezifikationen

KN419318G1, HNRNPA2B1 gRNA vector 1 in pCas-Guide CRISPR vector

KN419318G2, HNRNPA2B1 gRNA vector 2 in pCas-Guide CRISPR vector

KN419318D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


Celf3 Mouse Gene Knockout Kit (CRISPR)

Celf3 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.

Product images

Spezifikationen

KN503115G1, Celf3 gRNA vector 1 in pCas-Guide CRISPR vector

KN503115G2, Celf3 gRNA vector 2 in pCas-Guide CRISPR vector

KN503115D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

Need more donor DNA? Need a different donor DNA?

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT


Schau das Video: NOTFALL!!!!!! DER BITCOIN PREIS WIRD EINE BEWEGUNG MACHEN MIT DER KEINER RECHNET!!!!!!!!!!!! (Dezember 2022).